Trypeta flaveola

Coquillett, 1899 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tephritidae/Trypeta

At a glance

Occurrence records68

Data sources7

Biological traits0

DNA specimens7

eDNA detections5

Sources7 archives

Databases and archives Trypeta flaveola's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility68 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF68 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD7 specimens

01Narrative

Trypeta flaveola is a species of tephritid or fruit flies in the genus Trypeta of the family Tephritidae.flaveola

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trypeta flaveola has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes1

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Diversity (π)2.6%

Haplotypes1

BINs2

Where individuals differ — all 32 variable positions, in barcode order

31Cvariable

34Amostly conserved

91Cvariable

100Avariable

133Tvariable

163Tmostly conserved

178Tmostly conserved

193Cvariable

217Tvariable

220Avariable

235Tvariable

247Cvariable

262Avariable

307Avariable

313Tvariable

316Gmostly conserved

328Tvariable

340Cvariable

356Gmostly conserved

415Avariable

499Tvariable

526Avariable

553Avariable

557Tvariable

581Tmostly conserved

607Tvariable

613Cvariable

619Tvariable

622Avariable

631Avariable

640Cvariable

646Tmostly conserved

AACTTTATATTTTATTTTCGGTGCTTGAGCCGGAATAGTAGGAACATCTCTTAGTATTTTAATTCGAGCTGAATTAGGTCATCCAGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Trypeta zoesame genus4.1%Trypeta immaculatasame genus6.1%Euleia uncinatasame family6.5%Euleia fratriasame family6.5%Euleia heracleisame family7.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type68 records

Wild obs. + sensor47

Museum / vouchered21

Range

Area of Occupancy AOO224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 23≤1 km 7≤10 km 1>10 km 3

34 georeferenced · 13 without coordinates

Open the mapobservation + sensor47

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 1≤10 km 5

6 georeferenced · 15 without coordinates

Open the institutions mapphysical evidence21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Francisco, US	10
Essig Museum of Entomologylocation not on record	6
Washington, US	3
California Department for Food and Agriculturelocation not on record	1

4 institutions · 20 of 21 vouchered records shown · 1 without an institution code

09Environmental DNA5 detections

Where the DNA of Trypeta flaveola was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

4. Native Grassland|4.2 Subarctic Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.9 °C 12.1–16.0

Seasonal swing summer↔winter26.9 °C

Max temp (day)20.7 °C 17.6–22.4

Min temp (night)8.70 °C 7.20–10.5

Precipitation69.0 mm/mo 26.2–91.5

Air humidity56.9 % 47.1–60.4

Moisture balance-50.8 mm/mo -113–9.00

Vapour deficit769 Pa 587–891

Wind speed2.50 m/s 2.20–2.80

Cloud cover41.7 % 21.9–51.6

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)