Trypeta immaculata

(Macquart, 1835) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tephritidae/Trypeta

At a glance

Occurrence records432

Data sources6

Biological traits2

DNA specimens17

eDNA detections18

Sources6 archives

Databases and archives Trypeta immaculata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility432 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF432 records

Environmental DNA4 datasets · 5 countries18 detections

DNA & barcodingBOLD17 specimens

01Narrative

Trypeta immaculata is a species of tephritid or fruit flies in the genus Trypeta of the family Tephritidae.ITISNomen.at - animals and plantsGlobal Biodiversity Information Facility Video clip

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trypeta immaculata has left across the world's sequence archives.

At a glance

DNA specimens17

BINs2

Marker genes1

eDNA detections18

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 79 variable positions, in barcode order

16Tmostly conserved

19Gmostly conserved

37Tmostly conserved

46Tmostly conserved

49Tmostly conserved

76Tmostly conserved

91Tmostly conserved

97Tmostly conserved

103Tmostly conserved

127Amostly conserved

160Amostly conserved

187Amostly conserved

199Amostly conserved

217Amostly conserved

232Tmostly conserved

256Tmostly conserved

265Gmostly conserved

268Cmostly conserved

275Cmostly conserved

280Amostly conserved

292Tmostly conserved

304Tmostly conserved

313Amostly conserved

319Gmostly conserved

337Tmostly conserved

373Cmostly conserved

382Tmostly conserved

404Tmostly conserved

430Amostly conserved

451Tvariable

468Cmostly conserved

475Tmostly conserved

517Amostly conserved

526Tmostly conserved

535Amostly conserved

539Tmostly conserved

550Amostly conserved

554Cmostly conserved

568Tmostly conserved

574Gvariable

575Cmostly conserved

598Cvariable

601Amostly conserved

602Tmostly conserved

603Cmostly conserved

604Tmostly conserved

606Tmostly conserved

610Tmostly conserved

611Gvariable

612Avariable

613Tvariable

614Cvariable

616Avariable

617Gvariable

618Cvariable

619Avariable

620Gvariable

622Avariable

623Gvariable

625Avariable

626Gvariable

628Tvariable

629Gvariable

630Avariable

631Tvariable

632Cvariable

634Tvariable

635Avariable

636Tvariable

640Avariable

641Tvariable

642Avariable

643Cvariable

645Avariable

647Cvariable

648Avariable

649Tvariable

652Avariable

653Tvariable

TTTATATTTTATTTTTGGGGCTTGAGCTGGAATAGTTGGAACATCTCTTAGTATTTTAATTCGAGCTGAATTAGGTCACCCAGGAGCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.3%

Haplotypes3

BINs2

Most divergent pair6.6%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Trypeta flaveolasame genus6.1%Trypeta zoesame genus6.3%Euleia uncinatasame family6.9%Euleia fratriasame family6.9%Euleia heracleisame family7.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type432 records

Wild obs. + sensor272

Museum / vouchered160

Range

Area of Occupancy AOO1 248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 146≤1 km 82≤10 km 35

263 georeferenced · 9 without coordinates

Open the mapobservation + sensor272

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 41≤1 km 59≤10 km 27>10 km 1

128 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence160

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MZLUlocation not on record	49
Helsinki, FI	34
SLU Artdatabankenlocation not on record	14
Bavarian State Collection of Zoologylocation not on record	8
Stockholm, SE	7
BioFokuslocation not on record	6
South Kensington, GB	5
University of Tokyo, Department of Zoologylocation not on record	4
Metsähallituslocation not on record	4
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	3
Tromsø, NO	2
DFFW2018location not on record	2
NHMOlocation not on record	2
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1
Philadelphia, US	1
Gothenburg, SE	1
NTNU-VMlocation not on record	1

17 institutions · 144 of 160 vouchered records shown · 16 without an institution code

09Environmental DNA18 detections

Where the DNA of Trypeta immaculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys4

Countries5

Verifiable raw sequence linked10

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map5 countries0

Farmland, coast and birch habitatGarden and heatland, coastal habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.5 °C 12.4–15.1

Seasonal swing summer↔winter17.8 °C

Max temp (day)18.2 °C 13.4–19.0

Min temp (night)11.2 °C 8.40–11.9

Precipitation93.0 mm/mo 67.8–114

Air humidity61.4 % 60.5–63.7

Moisture balance2.90 mm/mo -53.9–21.6

Vapour deficit616 Pa 523–667

Wind speed3.60 m/s 2.60–5.20

Cloud cover53.4 % 39.8–60.1

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)