Trypeta artemisiae

(Fabricius, 1794) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tephritidae/Trypeta

At a glance

Occurrence records661

Data sources7

Biological traits1

DNA specimens13

eDNA detections9

Sources7 archives

Databases and archives Trypeta artemisiae's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility661 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF661 records

Environmental DNA1 datasets · 3 countries9 detections

DNA & barcodingBOLD13 specimens

01Narrative

Trypeta artemisiae is a species of tephritid or fruit flies in the genus Trypeta of the family Tephritidae.artemisiae Video of Trypeta artemisiae ovipositing

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging1

Feeding guild (adult)nectivore

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Trypeta artemisiae has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections9

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.04%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

646Cmostly conserved

AACCTTATATTTTATTTTCGGAGCTTGAGCTGGAATAGTAGGAACATCCCTTAGTATTCTAATTCGAGCTGAATTAGGTCATCCAGGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Trypeta zoesame genus7.1%Trypeta flaveolasame genus7.9%Trypeta immaculatasame genus8.6%Botanophila rubrigenasame order11.5%Botanophila adustasame order11.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type661 records

Wild obs. + sensor505

Museum / vouchered156

Range

Area of Occupancy AOO1 880 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy62% within 1 km

≤100 m 209≤1 km 88≤10 km 176>10 km 3

476 georeferenced · 29 without coordinates

Open the mapobservation + sensor505

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 18≤1 km 32≤10 km 79>10 km 2

131 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence156

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MZLUlocation not on record	51
Helsinki, FI	24
Iwate Prefectural Museumlocation not on record	15
SLU Artdatabankenlocation not on record	12
Stockholm, SE	10
Natural History Museum Rotterdamlocation not on record	9
South Kensington, GB	7
University of Tokyo, Department of Zoologylocation not on record	4
CBDClocation not on record	2
BioFokuslocation not on record	2
Bavarian State Collection of Zoologylocation not on record	2
NHMOlocation not on record	2
DFFW2018location not on record	1
DFlocation not on record	1
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	1
Tilburg, NL	1

16 institutions · 144 of 156 vouchered records shown · 12 without an institution code

09Environmental DNA9 detections

Where the DNA of Trypeta artemisiae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.9 °C 16.0–17.9

Seasonal swing summer↔winter14.8 °C

Max temp (day)21.8 °C 19.1–21.8

Min temp (night)14.0 °C 12.0–14.0

Precipitation75.8 mm/mo 73.6–78.1

Air humidity60.9 % 59.1–61.3

Moisture balance-21.6 mm/mo -49.3–-21.3

Vapour deficit801 Pa 696–821

Wind speed2.70 m/s 2.70–3.60

Cloud cover38.5 % 38.5–41.1

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)