Sphinx kalmiae

Smith, 1797 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Sphingidae/Sphinx

At a glance

Occurrence records4 592

Data sources7

Biological traits0

DNA specimens37

eDNA detections37

Sources7 archives

Databases and archives Sphinx kalmiae's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 592 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics37 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 592 records

Environmental DNA1 datasets · 2 countries37 detections

DNA & barcodingBOLD37 specimens

01Narrative

Sphinx kalmiae, the laurel sphinx, is a moth of the family Sphingidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding37 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sphinx kalmiae has left across the world's sequence archives.

At a glance

DNA specimens37

BINs1

Marker genes1

eDNA detections37

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus36 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

31Gvariable

160Gmostly conserved

211Amostly conserved

214Gmostly conserved

361Tmostly conserved

401Tmostly conserved

553Tmostly conserved

562Amostly conserved

628Amostly conserved

631Amostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCGGGAATAGTAGGAACTTCATTAAGTTTATTAATTCGTGCAGAATTAGGAAACCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.41%

Haplotypes9

BIN1

Most divergent pair1.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sphinx dolliisame genus4.3%Sphinx sequoiaesame genus4.4%Sphinx drupiferarumsame genus4.4%Sphinx vashtisame genus4.6%Sphinx canadensissame genus5.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 592 records

Wild obs. + sensor4 100

Museum / vouchered492

Range

Area of Occupancy AOO12 728 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 2 306≤1 km 535≤10 km 266>10 km 376

3 483 georeferenced · 617 without coordinates

Open the mapobservation + sensor4 100

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 11≤1 km 94≤10 km 180>10 km 37

322 georeferenced · 170 without coordinates

Open the institutions mapphysical evidence492

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	133
East Lansing, US	89
Cambridge, US	38
St. Paul, US	27
Cleveland Museum of Natural History, OH (CLEV)location not on record	25
Saint John, CA	22
Georgia Museum of Natural Historylocation not on record	17
University of Guelph, Centre for Biodiversity Genomicslocation not on record	15
Toronto, CA	14
Cornell University Insect Collectionlocation not on record	10
Philadelphia, US	8
Brussels, BE	7
Mississippi State, US	6
Vernal, US	5
RBINS-Scientific Heritagelocation not on record	4
Royal Saskatchewan Museumlocation not on record	4
Decorah, US	4
Colorado State Universitylocation not on record	4
OSUClocation not on record	3
Natural History Museum of Utahlocation not on record	3
SOVTlocation not on record	3
ASUlocation not on record	2
Espace pour la vielocation not on record	2
CUlocation not on record	2
Centre for Biodiversity Genomicslocation not on record	1
Washington, US	1
UDlocation not on record	1
Chicago, US	1
Champaign, US	1

29 institutions · 452 of 492 vouchered records shown · 40 without an institution code

09Environmental DNA37 detections

Where the DNA of Sphinx kalmiae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map2 countries0

GrasslandMixed HabitatTemperate mixed forestForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 11.4–21.4

Seasonal swing summer↔winter26.4 °C

Max temp (day)19.6 °C 16.5–25.3

Min temp (night)13.8 °C 6.70–17.4

Precipitation99.5 mm/mo 86.4–116

Air humidity59.8 % 57.5–63.8

Moisture balance-18.6 mm/mo -59.8–66.7

Vapour deficit690 Pa 561–1,032

Wind speed2.80 m/s 2.20–4.00

Cloud cover47.3 % 31.3–52.3

CHELSA 1981–2010, ~9 km grid, at location & month of 37 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Sphinx kalmiae

At a glance

Sources7 archives

At a glance

Record type4 592 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions14 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 592 records