Plagodis kuetzingi

(Grote, 1876) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Plagodis

At a glance

Occurrence records716

Data sources8

Biological traits0

DNA specimens9

eDNA detections9

Sources8 archives

Databases and archives Plagodis kuetzingi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility716 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF716 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD9 specimens

01Narrative

Plagodis kuetzingi, the purple plagodis, is a North American moth in the family Geometridae. It is an uncommon to rare moth.Charles V. Covell, Jr. (2005). Moths of Eastern North America. Virginia Museum of Natural History, Martinsville, VA. Mounted

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Plagodis kuetzingi has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes1

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

1Amostly conserved

22Amostly conserved

81Amostly conserved

127Cvariable

163Avariable

169Tvariable

181Gmostly conserved

211Amostly conserved

212Cmostly conserved

316Tmostly conserved

343Amostly conserved

346Tmostly conserved

412Tmostly conserved

421Cmostly conserved

469Amostly conserved

511Avariable

553Tvariable

565Amostly conserved

578Tmostly conserved

622Amostly conserved

631Gmostly conserved

640Tmostly conserved

AACATTATATTTTATTTTCGGAATTTGAGCAGGAATAGTGGGAACCTCATTAAGTTTATTAATTCGAGCAGAATTGGGTAACCCGGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes4

BIN1

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Plagodis serinariasame genus6.7%Plagodis fervidariasame genus6.8%Plagodis alcoolariasame genus7.3%Plagodis phlogosariasame genus7.6%Plagodis pulverariasame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type716 records

Wild obs. + sensor551

Museum / vouchered165

Range

Area of Occupancy AOO1 576 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 331≤1 km 70≤10 km 21>10 km 33

455 georeferenced · 96 without coordinates

Open the mapobservation + sensor551

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 28≤1 km 30≤10 km 60>10 km 4

122 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence165

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	55
ASUlocation not on record	29
East Lansing, US	21
Cleveland Museum of Natural History, OH (CLEV)location not on record	12
Toronto, CA	10
St. Paul, US	6
OSUClocation not on record	4
Cornell University Insect Collectionlocation not on record	4
Cambridge, US	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Colorado State Universitylocation not on record	2
Universidad Católica de Manizaleslocation not on record	2
Vernal, US	1
SOVTlocation not on record	1
UNHClocation not on record	1

15 institutions · 154 of 165 vouchered records shown · 11 without an institution code

09Environmental DNA9 detections

Where the DNA of Plagodis kuetzingi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.6 °C 15.7–19.2

Seasonal swing summer↔winter26.3 °C

Max temp (day)21.8 °C 21.0–24.0

Min temp (night)12.6 °C 11.5–14.7

Precipitation85.9 mm/mo 85.9–156

Air humidity58.9 % 58.0–62.8

Moisture balance-57.3 mm/mo -57.3–7.70

Vapour deficit775 Pa 732–840

Wind speed3.60 m/s 1.60–3.60

Cloud cover42.2 % 27.7–42.6

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)