Plagodis fervidaria

(Herrich-Schäffer) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Plagodis

At a glance

Occurrence records1 545

Data sources7

Biological traits0

DNA specimens30

eDNA detections19

Sources7 archives

Databases and archives Plagodis fervidaria's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 545 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 545 records

Environmental DNA1 datasets · 2 countries19 detections

DNA & barcodingBOLD30 specimens

01Narrative

Plagodis fervidaria, the fervid plagodis, is a species of geometrid moth in the family Geometridae. It is found in North America. The MONA or Hodges number for Plagodis fervidaria is 6843. Fervid plagodis, Plagodis fervidaria

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Plagodis fervidaria has left across the world's sequence archives.

At a glance

DNA specimens30

BINs2

Marker genes11

eDNA detections19

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 42 variable positions, in barcode order

1Amostly conserved

19Cmostly conserved

40Amostly conserved

85Amostly conserved

92Cmostly conserved

100Tmostly conserved

115Tmostly conserved

181Avariable

193Cvariable

202Amostly conserved

211Amostly conserved

220Tmostly conserved

232Tmostly conserved

235Cmostly conserved

238Tmostly conserved

271Amostly conserved

287Tmostly conserved

292Tmostly conserved

304Cmostly conserved

328Amostly conserved

337Tmostly conserved

343Tmostly conserved

370Avariable

379Amostly conserved

391Tvariable

403Avariable

406Cmostly conserved

412Tmostly conserved

421Tmostly conserved

428Cmostly conserved

433Amostly conserved

508Amostly conserved

550Amostly conserved

583Amostly conserved

589Tmostly conserved

595Tmostly conserved

601Tmostly conserved

610Cmostly conserved

634Tmostly conserved

637Tmostly conserved

646Cmostly conserved

652Tmostly conserved

AACATTATATTTTATTTTCGGAATTTGAGCAGGAATAGTAGGAACCTCATTAAGTTTATTAATTCGAGCAGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes10

BINs2

Most divergent pair5.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Plagodis serinariasame genus3.0%Plagodis dolabrariasame genus4.3%Plagodis alcoolariasame genus4.7%Plagodis phlogosariasame genus5.3%Plagodis pulverariasame genus6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P16S18S28SCADDDCEF1-alphaENOPERWnt1

animal barcoderibosomalmarker

08Occurrence & distribution

Record type1 545 records

Wild obs. + sensor1 266

Museum / vouchered279

Range

Area of Occupancy AOO2 840 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 614≤1 km 283≤10 km 63>10 km 112

1 072 georeferenced · 194 without coordinates

Open the mapobservation + sensor1 266

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 4≤1 km 42≤10 km 114>10 km 20

180 georeferenced · 99 without coordinates

Open the institutions mapphysical evidence279

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	91
East Lansing, US	54
St. Paul, US	35
Mississippi State, US	15
CUlocation not on record	10
Colorado State Universitylocation not on record	10
UDlocation not on record	8
Cleveland Museum of Natural History, OH (CLEV)location not on record	6
Toronto, CA	6
Cornell University Insect Collectionlocation not on record	5
OSUClocation not on record	4
Washington, US	3
Natural History Museum of Utahlocation not on record	2
Philadelphia, US	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
San Diego, US	2
Chicago, US	2
SOVTlocation not on record	2
King Saud Universitylocation not on record	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
University of Marylandlocation not on record	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
Blacksburg, US	1
Centre for Biodiversity Genomicslocation not on record	1

24 institutions · 265 of 279 vouchered records shown · 14 without an institution code

09Environmental DNA19 detections

Where the DNA of Plagodis fervidaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.1 °C 13.1–22.5

Seasonal swing summer↔winter20.6 °C

Max temp (day)23.9 °C 18.3–27.2

Min temp (night)14.9 °C 8.00–18.0

Precipitation125 mm/mo 81.4–155

Air humidity60.1 % 55.1–61.9

Moisture balance-28.3 mm/mo -46.4–15.5

Vapour deficit850 Pa 657–1,063

Wind speed2.80 m/s 1.90–3.50

Cloud cover32.6 % 27.7–47.4

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Plagodis fervidaria

At a glance

Sources7 archives

At a glance

Record type1 545 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 545 records