Plagodis phlogosaria

(Guenée) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Plagodis

At a glance

Occurrence records4 218

Data sources7

Biological traits0

DNA specimens114

eDNA detections113

Sources7 archives

Databases and archives Plagodis phlogosaria's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 218 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI113 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics114 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 218 records

Environmental DNA1 datasets · 2 countries113 detections

DNA & barcodingBOLD114 specimens

01Narrative

Plagodis phlogosaria, the scorched wing or straight-lined plagodis, is a species of moth of the family Geometridae. It is found in all of North America except the far south and Yukon and Alaska. The wingspan is 28–38 mm. The moth flies from April to August depending on the location. The larvae feed on alder, basswood, birch, black cherry, chokecherry, hazel and willow.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding114 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Plagodis phlogosaria has left across the world's sequence archives.

At a glance

DNA specimens114

BINs1

Marker genes1

eDNA detections113

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus111 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

100Gmostly conserved

217Amostly conserved

271Avariable

370Gmostly conserved

514Tmostly conserved

517Tvariable

542Cmostly conserved

646Tmostly conserved

GACATTATATTTTATTTTCGGAATTTGAGCAGGAATAGTGGGAACCTCATTAAGTTTATTAATTCGAGCAGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 50 variants.

Diversity (π)0.56%

Haplotypes50

BIN1

Most divergent pair2.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Plagodis fervidariasame genus5.3%Plagodis serinariasame genus5.5%Plagodis dolabrariasame genus6.7%Plagodis alcoolariasame genus7.0%Plagodis pulverariasame genus7.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 218 records

Wild obs. + sensor3 589

Museum / vouchered629

Range

Area of Occupancy AOO6 560 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 1 997≤1 km 586≤10 km 146>10 km 222

2 951 georeferenced · 638 without coordinates

Open the mapobservation + sensor3 589

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 12≤1 km 80≤10 km 171>10 km 15

278 georeferenced · 351 without coordinates

Open the institutions mapphysical evidence629

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	159
University of Alberta Museums (UAM)location not on record	93
East Lansing, US	83
University of Guelph, Centre for Biodiversity Genomicslocation not on record	43
Cleveland Museum of Natural History, OH (CLEV)location not on record	25
Colorado State Universitylocation not on record	24
UNHClocation not on record	23
Royal Saskatchewan Museumlocation not on record	21
Cornell University Insect Collectionlocation not on record	21
Toronto, CA	7
Cambridge, US	5
Decorah, US	4
Mississippi State, US	4
Vernal, US	4
Philadelphia, US	3
National Institute of Biological Resourceslocation not on record	3
OSUClocation not on record	3
Saint John, CA	3
Chicago, US	3
SOVTlocation not on record	3
University of Guelphlocation not on record	2
Denver, US	2
Centre for Biodiversity Genomicslocation not on record	2
Biodiversity Institute of Ontariolocation not on record	1
San Francisco, US	1
St. Paul, US	1
UDlocation not on record	1

27 institutions · 544 of 629 vouchered records shown · 85 without an institution code

09Environmental DNA113 detections

Where the DNA of Plagodis phlogosaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found113

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 113 detections have coordinates

Open the map2 countries0

farmTemperate mixed forestRiparian ZoneGrasslandForest14. Artificial - Terrestrial|14.5 Urban Areas

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.0 °C 11.2–20.4

Seasonal swing summer↔winter26.1 °C

Max temp (day)18.6 °C 14.2–25.7

Min temp (night)10.2 °C 7.10–16.0

Precipitation86.2 mm/mo 71.7–111

Air humidity58.5 % 55.2–62.8

Moisture balance-53.6 mm/mo -66.9–0.7

Vapour deficit667 Pa 528–1,016

Wind speed3.40 m/s 2.10–5.30

Cloud cover42.5 % 37.0–48.1

CHELSA 1981–2010, ~9 km grid, at location & month of 111 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Plagodis phlogosaria

At a glance

Sources7 archives

At a glance

Record type4 218 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 218 records