Plagodis serinaria

(Herrich-Schäffer) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Plagodis

At a glance

Occurrence records1 967

Data sources7

Biological traits0

DNA specimens28

eDNA detections27

Sources7 archives

Databases and archives Plagodis serinaria's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 967 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 967 records

Environmental DNA1 datasets · 2 countries27 detections

DNA & barcodingBOLD28 specimens

01Narrative

Plagodis serinaria, the lemon plagodis, is a species of geometrid moth in the family Geometridae. It is found in North America. The MONA or Hodges number for Plagodis serinaria is 6840.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Plagodis serinaria has left across the world's sequence archives.

At a glance

DNA specimens28

BINs1

Marker genes4

eDNA detections27

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

19Cmostly conserved

20Gmostly conserved

34Amostly conserved

40Gmostly conserved

160Amostly conserved

181Amostly conserved

217Gmostly conserved

271Amostly conserved

318Cmostly conserved

322Amostly conserved

328Gvariable

340Cmostly conserved

347Cmostly conserved

370Gmostly conserved

391Cmostly conserved

433Gmostly conserved

517Gvariable

523Tmostly conserved

538Amostly conserved

610Cmostly conserved

646Cmostly conserved

AACATTATATTTTATTTTCGGAATTTGAGCAGGAATAGTGGGAACCTCATTAAGTTTATTAATTCGAGCAGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes18

BIN1

Most divergent pair1.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Plagodis fervidariasame genus3.0%Plagodis alcoolariasame genus4.1%Plagodis phlogosariasame genus5.5%Plagodis dolabrariasame genus5.8%Plagodis pulverariasame genus6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S28S

animal barcoderibosomalmarker

08Occurrence & distribution

Record type1 967 records

Wild obs. + sensor1 602

Museum / vouchered365

Range

Area of Occupancy AOO3 528 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 912≤1 km 223≤10 km 62>10 km 108

1 305 georeferenced · 297 without coordinates

Open the mapobservation + sensor1 602

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 4≤1 km 64≤10 km 176>10 km 4

248 georeferenced · 117 without coordinates

Open the institutions mapphysical evidence365

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	155
Cleveland Museum of Natural History, OH (CLEV)location not on record	48
East Lansing, US	31
ASUlocation not on record	23
UNHClocation not on record	13
Toronto, CA	13
Cambridge, US	11
Washington, US	9
University of Guelph, Centre for Biodiversity Genomicslocation not on record	7
SOVTlocation not on record	5
Cornell University Insect Collectionlocation not on record	5
OSUClocation not on record	4
Chicago, US	4
University Park, US	4
Colorado State Universitylocation not on record	4
Saint John, CA	3
UDlocation not on record	2
St. Paul, US	2
Espace pour la vielocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

20 institutions · 345 of 365 vouchered records shown · 20 without an institution code

09Environmental DNA27 detections

Where the DNA of Plagodis serinaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map2 countries0

Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 11.2–20.6

Seasonal swing summer↔winter27.8 °C

Max temp (day)20.9 °C 16.5–23.9

Min temp (night)11.2 °C 6.40–17.7

Precipitation109 mm/mo 93.8–136

Air humidity58.3 % 55.7–60.3

Moisture balance-15.9 mm/mo -79.3–15.7

Vapour deficit735 Pa 560–1,018

Wind speed2.50 m/s 2.20–5.30

Cloud cover44.4 % 39.1–51.9

CHELSA 1981–2010, ~9 km grid, at location & month of 24 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Plagodis serinaria

At a glance

Sources7 archives

At a glance

Record type1 967 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 967 records