Neverita lewisii

(A.Gould, 1847) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Littorinimorpha/Naticidae/Neverita

At a glance

Occurrence records4 908

Data sources8

Biological traits5

DNA specimens18

eDNA detections6

Sources8 archives

Databases and archives Neverita lewisii's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 251 records↗

OBISOcean Biodiversity Information System657 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS4 908 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD18 specimens

01Narrative

Neverita lewisii (previously known as Polinices lewisii, Lunatia lewisii, Euspira lewisii), common name Lewis's moon snail, is a species of large operculated sea snail. It is a predatory marine gastropod in the family Naticidae, the moon snails.Bouchet, P. (2012). Lunatia lewisii (Gould, 1847). Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=584785 on 2012-08-16 Traditionally, this species was assigned to either the genus Lunatia, the genus Polinices or the genus Euspira. Recently, it was assigned to the genus Neverita based on molecular data.Huelsken, T., Tapken, D., Dahlmann, T., Wägele, H., Riginos, C., Hollmann, M. (2012). Systematics and phylogenetic species delimitation within Polinices s.l. (Caenogastropoda: Naticidae) based on molecular data and shell morphology. Organisms Diversity & Evolution. DOI: 10.1007/s13127-012-0111-5. This is the largest species in the family.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length14 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max50 m

Depth min0 m

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neverita lewisii has left across the world's sequence archives.

At a glance

DNA specimens18

BINs2

Marker genes2

eDNA detections6

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Diversity (π)6.0%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 98 variable positions, in barcode order

34Gmostly conserved

37Amostly conserved

40Amostly conserved

49Cmostly conserved

50Tmostly conserved

52Amostly conserved

55Amostly conserved

58Amostly conserved

74Cmostly conserved

79Tmostly conserved

82Gmostly conserved

88Gmostly conserved

91Amostly conserved

94Gmostly conserved

97Tmostly conserved

100Tmostly conserved

110Tmostly conserved

112Amostly conserved

118Cmostly conserved

127Amostly conserved

130Gmostly conserved

145Tmostly conserved

184Amostly conserved

187Cmostly conserved

197Cmostly conserved

199Amostly conserved

202Cmostly conserved

205Gmostly conserved

206Cmostly conserved

208Gmostly conserved

212Tmostly conserved

223Amostly conserved

226Cmostly conserved

229Gmostly conserved

232Tmostly conserved

238Amostly conserved

241Amostly conserved

242Cmostly conserved

244Gmostly conserved

259Cmostly conserved

263Cmostly conserved

265Tmostly conserved

271Cmostly conserved

274Gmostly conserved

277Cmostly conserved

280Gmostly conserved

283Amostly conserved

289Gmostly conserved

295Gmostly conserved

301Tmostly conserved

304Gmostly conserved

307Amostly conserved

313Amostly conserved

319Tmostly conserved

322Gmostly conserved

325Amostly conserved

343Cmostly conserved

346Tmostly conserved

358Cmostly conserved

359Cmostly conserved

367Cmostly conserved

370Cmostly conserved

403Gmostly conserved

407Tmostly conserved

409Gmostly conserved

418Tmostly conserved

424Tmostly conserved

454Amostly conserved

458Gmostly conserved

460Cmostly conserved

466Gmostly conserved

469Gmostly conserved

484Gmostly conserved

490Gmostly conserved

496Amostly conserved

499Amostly conserved

500Cmostly conserved

508Gmostly conserved

511Amostly conserved

517Amostly conserved

526Gmostly conserved

529Amostly conserved

538Gmostly conserved

539Tmostly conserved

541Amostly conserved

547Tmostly conserved

553Tmostly conserved

562Amostly conserved

577Gmostly conserved

589Tmostly conserved

592Amostly conserved

613Tmostly conserved

619Gmostly conserved

622Tmostly conserved

625Gmostly conserved

631Gmostly conserved

640Cmostly conserved

646Cmostly conserved

TACTTTATATATTTTATTTGGAATGTGATCTGGGTTAGTAGGAACTGCCTTAAGATTACTTATTCGAGCTGAACTAGGTCAGCCAGGGGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Neverita didymasame genus10.2%Glossaulax petiverianasame family12.0%Euspira fuscasame family12.8%Euspira montaguisame family13.1%Cryptonatica aleuticasame family14.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P28S

animal barcodemarker

08Occurrence & distribution

Record type4 908 records

Wild obs. + sensor4 678

Museum / vouchered182

Fossil48

Range

Area of Occupancy AOO5 704 km²

Depth

0–200 m sunlit73

200–1000 m twilight4

1–4 km midnight0

>4 km abyssal0

median 20.1 m · max 373 m · 77 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 2 092≤1 km 839≤10 km 141>10 km 197

3 269 georeferenced · 1 409 without coordinates

Open the mapobservation + sensor4 678

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 4≤1 km 9≤10 km 26>10 km 13

52 georeferenced · 130 without coordinates

Open the institutions mapphysical evidence182

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara Museum of Natural Historylocation not on record	36
Philadelphia, US	16
Cambridge, US	11
Chongqing Museumlocation not on record	10
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	9
Champaign, US	7
Florida Museum of Natural Historylocation not on record	7
Natural History Museum Rotterdamlocation not on record	6
Denver, US	4
Royal British Columbia Museumlocation not on record	2
Delaware Museum of Nature and Sciencelocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	2
Brussels, BE	1
Los Angeles, US	1
RBINS-Scientific Heritagelocation not on record	1
Seattle, US	1
Gothenburg, SE	1
Chicago, US	1
New Haven, US	1
Hakai Institutelocation not on record	1
CASlocation not on record	1
Victoria, CA	1

22 institutions · 122 of 182 vouchered records shown · 3 without an institution code

09Environmental DNA6 detections

Where the DNA of Neverita lewisii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

rocky reefPlanktonic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.1 °C 6.90–15.7

Seasonal swing summer↔winter15.6 °C

Max temp (day)12.9 °C 9.00–20.8

Min temp (night)10.0 °C 3.10–12.7

Precipitation66.2 mm/mo 51.3–218

Air humidity63.0 % 58.9–68.2

Vapour deficit446 Pa 370–744

Cloud cover41.6 % 37.5–52.3

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Neverita lewisii

At a glance

Sources8 archives

Size & morphology1

Habitat & environment2

Other traits2

At a glance

Record type4 908 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 908 records