Euspira fusca

(Blainville, 1825) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Littorinimorpha/Naticidae/Euspira

At a glance

Occurrence records744

Data sources8

Biological traits2

DNA specimens21

eDNA detections18

Sources8 archives

Databases and archives Euspira fusca's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility408 records↗

OBISOcean Biodiversity Information System336 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS744 records

Environmental DNA1 datasets · 3 countries18 detections

DNA & barcodingBOLD21 specimens

01Narrative

Euspira fusca, common name the dark necklace shell, is a species of predatory sea snail, a marine gastropod mollusk in the family Naticidae, the moon snails.Bouchet, P.; Gofas, S. (2015). Euspira fusca (Blainville, 1825). In: MolluscaBase (2015). Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php/aphia.php?p=taxdetails&id=140529 on 2015-06-21

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euspira fusca has left across the world's sequence archives.

At a glance

DNA specimens21

BINs2

Marker genes1

eDNA detections18

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 45 variable positions, in barcode order

37Amostly conserved

43Gvariable

58Gmostly conserved

82Amostly conserved

100Gmostly conserved

106Cmostly conserved

118Cmostly conserved

166Amostly conserved

175Amostly conserved

184Tmostly conserved

196Amostly conserved

206Cmostly conserved

229Gmostly conserved

244Amostly conserved

259Cmostly conserved

262Gmostly conserved

280Gmostly conserved

286Amostly conserved

289Amostly conserved

316Gmostly conserved

322Avariable

340Tmostly conserved

343Cmostly conserved

346Tmostly conserved

352Cmostly conserved

367Tmostly conserved

370Tmostly conserved

412Tmostly conserved

418Cmostly conserved

445Tmostly conserved

451Cmostly conserved

460Cvariable

484Gmostly conserved

511Amostly conserved

526Amostly conserved

550Amostly conserved

557Tmostly conserved

559Avariable

562Tmostly conserved

565Tmostly conserved

571Tmostly conserved

577Gmostly conserved

613Tmostly conserved

631Amostly conserved

634Tmostly conserved

TACTTTATATATTTTATTTGGTATGTGATCAGGACTAGTTGGGACTGCTCTTAGATTGCTTATTCGAGCTGAATTAGGTCAACCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes7

BINs2

Most divergent pair0.91%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euspira montaguisame genus9.7%Euspira catenasame genus10.2%Cryptonatica aleuticasame family10.7%Euspira nitidasame genus10.9%Polinices mammillasame family11.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type744 records

Wild obs. + sensor207

Museum / vouchered257

Fossil5

Other275

Origin

Native1

Range

Area of Occupancy AOO2 068 km²

Depth

0–200 m sunlit178

200–1000 m twilight106

1–4 km midnight0

>4 km abyssal0

median 118.9 m · max 807 m · 284 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 177≤1 km 2

179 georeferenced · 28 without coordinates

Open the mapobservation + sensor207

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 5≤1 km 16≤10 km 14>10 km 15

50 georeferenced · 207 without coordinates

Open the institutions mapphysical evidence257

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ICATMARlocation not on record	42
Natural History Museum Rotterdamlocation not on record	21
Paris, FR	15
CEFASlocation not on record	12
Barcelona, ES	9
Frankfurt am Main	8
Santa Barbara Museum of Natural Historylocation not on record	6
Biomorlocation not on record	6
ICM-CSIClocation not on record	5
Denver, US	3
Hellenic Centre of Marine Research; Institute for Oceanographylocation not on record	3
University Museum of Bergen, Natural History Collectionslocation not on record	3
RBINS-Scientific Heritagelocation not on record	3
Brussels, BE	3
Philadelphia, US	3
Institut Francais pour l'Etude de la Merlocation not on record	3
AUTHlocation not on record	3
IEO-COMA-CSIClocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Chongqing Museumlocation not on record	2
Stockholm, SE	1
486location not on record	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1
Delaware Museum of Nature and Sciencelocation not on record	1

24 institutions · 158 of 257 vouchered records shown · 21 without an institution code

09Environmental DNA18 detections

Where the DNA of Euspira fusca was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.9 °C 5.90–19.2

Seasonal swing summer↔winter8.00 °C

Max temp (day)13.8 °C 6.70–19.8

Min temp (night)10.6 °C 5.10–18.6

Precipitation51.7 mm/mo 11.4–73.9

Air humidity66.1 % 62.5–69.3

Vapour deficit488 Pa 344–692

Cloud cover52.3 % 22.5–53.0

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)