Euspira nitida
(Donovan, 1803) · speciesAt a glance
Occurrence records42 848
Data sources8
Biological traits5
DNA specimens65
eDNA detections19
Sources8 archives
Databases and archives Euspira nitida's data was compiled from.
WikipediaWikimedia Foundation4 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility24 245 records↗
OBISOcean Biodiversity Information System18 603 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics65 specimens↗
Catalogue of LifeCOLtaxonomy↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements1 literature sources5 traits
Occurrence & distributionGBIF · OBIS42 848 records
Environmental DNA2 datasets · 5 countries19 detections
DNA & barcodingBOLD65 specimens
01Narrative
Euspira nitida (common name : common necklace shell) is a species of sea snail, a marine gastropod mollusc in the family Naticidae, the moon snails.Bouchet, P.; Gofas, S. (2015). Euspira nitida (Donovan, 1804). In: MolluscaBase (2015). Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=151894 on 2015-06-21
No narrative description available for this taxon yet.
02Traits & measurements
SourcesSeaLifeBase
Habitat & environment3
Habitat brackishyes
Habitat saltwateryes
Habitat zonebenthic
Other traits2
Depth max400 m
Depth min11 m
05DNA & barcoding65 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euspira nitida has left across the world's sequence archives.
At a glance
DNA specimens65
BINs2
Marker genes2
eDNA detections19
Countries5
The DNA barcodethe species' typical barcode, built from every sequenced specimen
COI-5P658 bp consensus16 specimens
ACGT
▸ drag or hover over the strip to read any position — letter and how much it varies
Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 84% of positions are identical in every specimen.
Where individuals differ — all 102 variable positions, in barcode order
43Gmostly conserved
49Cmostly conserved
50Cmostly conserved
52Tmostly conserved
59Cmostly conserved
61Tmostly conserved
94Tmostly conserved
95Cmostly conserved
97Gmostly conserved
109Gmostly conserved
110Cmostly conserved
112Tmostly conserved
118Cmostly conserved
127Tmostly conserved
142Tmostly conserved
145Amostly conserved
157Tmostly conserved
169Amostly conserved
175Gmostly conserved
181Gmostly conserved
184Tmostly conserved
190Amostly conserved
193Tmostly conserved
206Cmostly conserved
214Amostly conserved
217Gmostly conserved
223Tmostly conserved
229Gmostly conserved
235Tmostly conserved
241Cmostly conserved
242Cmostly conserved
256Tmostly conserved
259Cmostly conserved
265Tmostly conserved
266Tmostly conserved
268Amostly conserved
271Tmostly conserved
274Amostly conserved
277Cmostly conserved
280Gmostly conserved
284Tmostly conserved
286Gmostly conserved
287Tmostly conserved
289Gmostly conserved
290Cmostly conserved
292Gmostly conserved
301Tmostly conserved
304Gmostly conserved
319Amostly conserved
322Tmostly conserved
325Amostly conserved
346Cmostly conserved
352Tmostly conserved
355Amostly conserved
376Tmostly conserved
379Amostly conserved
397Cmostly conserved
400Gmostly conserved
407Cmostly conserved
412Cmostly conserved
415Gmostly conserved
424Gvariable
428Tmostly conserved
433Gmostly conserved
442Cmostly conserved
445Tmostly conserved
454Tmostly conserved
460Tmostly conserved
475Avariable
478Tmostly conserved
481Amostly conserved
493Cmostly conserved
494Tmostly conserved
496Amostly conserved
500Cmostly conserved
502Tmostly conserved
514Amostly conserved
520Gmostly conserved
529Tmostly conserved
536Cmostly conserved
538Tmostly conserved
539Cmostly conserved
541Tmostly conserved
542Tmostly conserved
544Amostly conserved
547Cmostly conserved
553Tmostly conserved
556Amostly conserved
559Tmostly conserved
562Tmostly conserved
565Tmostly conserved
595Tmostly conserved
607Amostly conserved
616Tmostly conserved
625Avariable
628Amostly conserved
631Amostly conserved
637Tmostly conserved
646Cmostly conserved
649Gmostly conserved
653Cmostly conserved
658Tmostly conserved
TACTCTATACATTTTATTTGGTATGTGATCTGGGTTAGTCGGGACTGCCCTTAGATTACTTATTCGAGCTGAATTAGGACAACCAGGAGC …
Variant network
Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.
Diversity (π)2.6%
Haplotypes7
BINs2
Most divergent pair1.8%
OtherEurope
Closest relatives by DNA barcode
The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P18S-5P
animal barcoderibosomal
08Occurrence & distribution
Record type42 848 records
Wild obs. + sensor11 919
Museum / vouchered20 170
Fossil25
Other10 734
Origin
Native27
Range
Area of Occupancy AOO33 456 km²
Depth
0–200 m sunlit9 143
200–1000 m twilight36
1–4 km midnight0
>4 km abyssal0
median 30.9 m · max 999 m · 9 179 records with depth
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy82% within 1 km
≤100 m 7 461≤1 km 428≤10 km 1 679>10 km 21
9 589 georeferenced · 2 330 without coordinates
Open the mapobservation + sensor11 919
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy73% within 1 km
≤100 m 418≤1 km 405≤10 km 236>10 km 61
1 120 georeferenced · 19 050 without coordinates
Open the institutions mapphysical evidence20 170
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions17 of 66 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| CEFASlocation not on record | 3 190 |
| RWSlocation not on record | 2 389 |
| WMR_IMARESlocation not on record | 1 790 |
| Institut Francais pour l'Etude de la Merlocation not on record | 410 |
| 730location not on record | 376 |
| Bergen, NO | 299 |
| 486location not on record | 244 |
| SLU Artdatabankenlocation not on record | 188 |
| DASSHlocation not on record | 143 |
| Research Institute for Agriculture, Fisheries and Food (ILVO)location not on record | 142 |
| Station Biologique de Roscoff (EDMO:521)location not on record | 114 |
| Paris, FR | 113 |
| Natural History Museum Rotterdamlocation not on record | 99 |
| NTNU-VMlocation not on record | 96 |
| Gothenburg, SE | 93 |
| Frankfurt am Main | 67 |
| Rijkswaterstaatlocation not on record | 67 |
| Laboratoria di biologia marina di Triestelocation not on record | 57 |
| MZLUlocation not on record | 54 |
| PNHSlocation not on record | 42 |
| Deutsches Zentrum fuer Marine Biodiversitaetsforschunglocation not on record | 38 |
| Hellenic Centre of Marine Research; Institute for Oceanographylocation not on record | 30 |
| AUTHlocation not on record | 26 |
| Laboratoire d'Océanographie Biologique, Universite de Bordeaxlocation not on record | 22 |
| Biomorlocation not on record | 18 |
| Brussels, BE | 15 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Université de Liège Underwater research and oceanographic station (4501)location not on record | 15 |
| 630location not on record | 14 |
| UGentlocation not on record | 12 |
| BioFokuslocation not on record | 10 |
| RBINS-Scientific Heritagelocation not on record | 10 |
| Tromsø, NO | 9 |
| Université de Liège Underwater research and oceanographic station (4501)location not on record | 9 |
| Philadelphia, US | 8 |
| Helsinki, FI | 7 |
| Citadel Hill, GB | 7 |
| Cambridge, US | 6 |
| Santa Barbara Museum of Natural Historylocation not on record | 6 |
| Denver, US | 4 |
| Bergen, NO | 4 |
| Israel Oceanographic & Limnological Research, Ltd. The National Institute of Oceanographylocation not on record | 4 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 3 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Phaxas Expertise Of Marine Fauna (4507)location not on record | 3 |
| Goteborg Natural History Museumlocation not on record | 2 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503)location not on record | 2 |
| University Museum of Bergen, Natural History Collectionslocation not on record | 2 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Phaxas Expertise Of Marine Fauna (4507) Université de Liège Underwater research and oceanographic station (4501)location not on record | 2 |
| HCMRlocation not on record | 2 |
| CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Université de Liège Underwater research and oceanographic station (4501)location not on record | 2 |
| Chongqing Museumlocation not on record | 2 |
| Norwegian Institute of Marine Researchlocation not on record | 2 |
| Salzburg, AT | 2 |
| Champaign, US | 2 |
| Turkmen Agricultural University named after S.A. Niyazovlocation not on record | 1 |
| DIHOlocation not on record | 1 |
| Dipartimento di Scienze della vita e dell'ambiente dell'Università Politecnica delle Marche | Department of Life and Environmental Sciences of the Marche Polytechnic Universitylocation not on record | 1 |
| MHN-UPlocation not on record | 1 |
| SNSDlocation not on record | 1 |
| ICM-CSIClocation not on record | 1 |
| Toronto, CA | 1 |
| CLOlocation not on record | 1 |
| Auckland, NZ | 1 |
| Delaware Museum of Nature and Sciencelocation not on record | 1 |
| Paleontological Research Institutionlocation not on record | 1 |
| Laboratorio di Ecologia del Benthos | Benthos Ecology Laboratorylocation not on record | 1 |
| Stockholm, SE | 1 |
66 institutions · 10 286 of 20 170 vouchered records shown · 1 948 without an institution code
09Environmental DNA19 detections
Where the DNA of Euspira nitida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found19
Studies independent surveys2
Countries5
Verifiable raw sequence linked2
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 19 detections have coordinates
Open the map5 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median9.20 °C 0.8–15.3
Seasonal swing summer↔winter12.5 °C
Max temp (day)9.90 °C 2.50–16.8
Min temp (night)7.50 °C -1.40–13.9
Precipitation73.9 mm/mo 39.1–97.0
Air humidity64.8 % 62.4–66.2
Vapour deficit409 Pa 229–654
Cloud cover49.7 % 39.3–56.5
CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.