Euspira montagui

(Forbes, 1838) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Littorinimorpha/Naticidae/Euspira

At a glance

Occurrence records16 840

Data sources8

Biological traits4

DNA specimens25

eDNA detections0

Sources8 archives

Databases and archives Euspira montagui's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility12 051 records↗

OBISOcean Biodiversity Information System4 789 records↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS16 840 records

DNA & barcodingBOLD25 specimens

01Narrative

Euspira montagui is a species of predatory sea snail, a marine gastropod mollusk in the family Naticidae, the moon snails.Gofas, S.; Bouchet, P. (2015). Euspira montagui. In: MolluscaBase (2015). Accessed through: World Register of Marine Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=140533 on 2015-06-21

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max200 m

Depth min15 m

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Euspira montagui has left across the world's sequence archives.

At a glance

DNA specimens25

BINs1

Marker genes1

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

337Tmostly conserved

349Amostly conserved

370Cmostly conserved

385Cmostly conserved

481Gmostly conserved

496Amostly conserved

547Cmostly conserved

565Tmostly conserved

601Cmostly conserved

TACTCTATATATTTTATTTGGTATATGATCTGGGTTAGTAGGAACTGCTCTTAGGTTACTTATTCGAGCTGAATTAGGACAACCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.21%

Haplotypes3

BIN1

Most divergent pair0.46%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Euspira catenasame genus6.8%Euspira fuscasame genus9.7%Polinices mammillasame family9.9%Euspira nitidasame genus10.3%Cryptonatica aleuticasame family11.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type16 840 records

Wild obs. + sensor7 176

Museum / vouchered6 984

Other2 680

Range

Area of Occupancy AOO16 072 km²

Depth

0–200 m sunlit2 920

200–1000 m twilight1 490

1–4 km midnight1

>4 km abyssal0

median 119.8 m · max 1 877.5 m · 4 411 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 6 645≤1 km 18≤10 km 48>10 km 1

6 712 georeferenced · 464 without coordinates

Open the mapobservation + sensor7 176

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy85% within 1 km

≤100 m 116≤1 km 317≤10 km 69>10 km 9

511 georeferenced · 6 473 without coordinates

Open the institutions mapphysical evidence6 984

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bergen, NO	241
NTNU-VMlocation not on record	138
CEFASlocation not on record	127
Frankfurt am Main	89
SLU Artdatabankenlocation not on record	76
Bergen, NO	69
Gothenburg, SE	48
Norwegian Institute of Marine Researchlocation not on record	39
Natural History Museum Rotterdamlocation not on record	23
DASSHlocation not on record	18
PNHSlocation not on record	13
Tromsø, NO	12
Stockholm, SE	11
Deutsches Zentrum fuer Marine Biodiversitaetsforschunglocation not on record	9
730location not on record	9
RWSlocation not on record	5
Paris, FR	5
MZLUlocation not on record	4
Brussels, BE	4
Santa Barbara Museum of Natural Historylocation not on record	4
BioFokuslocation not on record	4
RBINS-Scientific Heritagelocation not on record	3
Cambridge, US	2
Champaign, US	1
Station Biologique de Roscoff (EDMO:521)location not on record	1
University Museum of Bergen, Natural History Collectionslocation not on record	1
630location not on record	1
Philadelphia, US	1
RMNHlocation not on record	1
Auckland, NZ	1
Chongqing Museumlocation not on record	1

31 institutions · 961 of 6 984 vouchered records shown · 2 873 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Euspira montagui

At a glance

Sources8 archives

Habitat & environment2

Other traits2

At a glance

Record type16 840 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 31 geolocated

Record type16 840 records