Neverita didyma

(Röding, 1798) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Littorinimorpha/Naticidae/Neverita

At a glance

Occurrence records3 019

Data sources8

Biological traits7

DNA specimens15

eDNA detections10

Sources8 archives

Databases and archives Neverita didyma's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 836 records↗

OBISOcean Biodiversity Information System1 183 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS3 019 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD15 specimens

01Narrative

Neverita didyma, common name the bladder moon snail or moon shell, is a species of predatory sea snail, a marine gastropod mollusc in the family Naticidae, the moon snails. Egg mass

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length8.5 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max100 m

Depth min0 m

Vulnerability10

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Neverita didyma has left across the world's sequence archives.

At a glance

DNA specimens15

BINs6

Marker genes1

eDNA detections10

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P644 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 81% of positions are identical in every specimen.

Where individuals differ — all 124 variable positions, in barcode order

6Gmostly conserved

8Amostly conserved

13Gmostly conserved

17Cmostly conserved

20Amostly conserved

35Cvariable

53Amostly conserved

56Tmostly conserved

59Amostly conserved

62Avariable

65Tmostly conserved

68Amostly conserved

71Amostly conserved

77Amostly conserved

78Tmostly conserved

80Avariable

89Tmostly conserved

95Gvariable

98Amostly conserved

101Tmostly conserved

107Avariable

113Amostly conserved

116Amostly conserved

131Tmostly conserved

146Tmostly conserved

158Amostly conserved

161Avariable

167Tmostly conserved

170Gvariable

176Amostly conserved

179Tmostly conserved

181Gmostly conserved

183Tmostly conserved

185Gmostly conserved

191Gvariable

192Cmostly conserved

194Amostly conserved

197Avariable

198Tvariable

200Avariable

203Amostly conserved

215Gvariable

221Tvariable

224Gvariable

227Amostly conserved

228Tmostly conserved

230Amostly conserved

245Tmostly conserved

247Gmostly conserved

248Amostly conserved

252Tmostly conserved

254Avariable

257Tvariable

267Tvariable

269Amostly conserved

270Tvariable

275Amostly conserved

281Amostly conserved

284Avariable

290Avariable

293Amostly conserved

299Avariable

302Gmostly conserved

305Tmostly conserved

308Avariable

311Avariable

317Amostly conserved

323Tvariable

326Tmostly conserved

332Tmostly conserved

344Tmostly conserved

345Tvariable

347Gmostly conserved

353Tvariable

356Tvariable

365Tmostly conserved

368Gvariable

371Tmostly conserved

387Cmostly conserved

389Tmostly conserved

395Amostly conserved

407Tmostly conserved

416Amostly conserved

425Amostly conserved

431Tvariable

434Tmostly conserved

440Avariable

449Tmostly conserved

455Amostly conserved

457Gmostly conserved

461Avariable

464Gvariable

467Amostly conserved

473Tmostly conserved

476Amostly conserved

479Gmostly conserved

482Amostly conserved

486Tmostly conserved

488Amostly conserved

494Amostly conserved

497Avariable

506Gvariable

512Gvariable

521Amostly conserved

524Avariable

525Tmostly conserved

530Amostly conserved

534Tmostly conserved

536Gmostly conserved

539Avariable

542Gvariable

545Amostly conserved

548Avariable

551Amostly conserved

575Tmostly conserved

578Amostly conserved

593Tmostly conserved

596Tmostly conserved

602Tmostly conserved

605Tmostly conserved

+4 more variable positions not shown

TATTTGGAATATGATCCGGATTGGTAGGAACTGCCTTAAGATTACTTATTCGAGCTGAATTAGGTCAACCAGGAGCATTACTTGGTGATG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)7.3%

Haplotypes5

BINs6

Most divergent pair11.8%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Glossaulax petiverianasame family4.5%Neverita lewisiisame genus10.2%Polinices mammillasame family10.3%Cryptonatica aleuticasame family10.7%Colus gracilissame order11.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_046594 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX1COX2ATP8ATP6ND1ND6CYTBND4LND4ND5COX3ND3ND212S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type3 019 records

Wild obs. + sensor1 166

Museum / vouchered1 790

Fossil63

Range

Area of Occupancy AOO4 612 km²

Depth

0–200 m sunlit34

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 28 m · max 91.4 m · 34 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 438≤1 km 120≤10 km 34>10 km 21

613 georeferenced · 553 without coordinates

Open the mapobservation + sensor1 166

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy61% within 1 km

≤100 m 21≤1 km 585≤10 km 306>10 km 79

991 georeferenced · 799 without coordinates

Open the institutions mapphysical evidence1 790

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	341
National Marine Biodiversity Institute of Korealocation not on record	162
Museum and Art Gallery of the Northern Territorylocation not on record	84
Museums Victorialocation not on record	82
Philadelphia, US	61
QVMAGlocation not on record	45
Cambridge, US	35
Natick, US	21
Natural History Museum Rotterdamlocation not on record	20
Santa Barbara Museum of Natural Historylocation not on record	12
Brussels, BE	12
CASlocation not on record	11
Chongqing Museumlocation not on record	9
RBINS-Scientific Heritagelocation not on record	9
Tomioka, JP	6
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	5
NTNU-VMlocation not on record	3
Denver, US	3
Western Australian Museumlocation not on record	2
ELMClocation not on record	2
Toronto, CA	2
Paleontological Research Institutionlocation not on record	2
Muséum d'histoire naturelle de Marseillelocation not on record	1
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	1
Auckland, NZ	1
Delaware Museum of Nature and Sciencelocation not on record	1
Frankfurt am Main	1

27 institutions · 934 of 1 790 vouchered records shown · 8 without an institution code

09Environmental DNA10 detections

Where the DNA of Neverita didyma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–10.0

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C

Min temp (night)3.10 °C

Precipitation13.8 mm/mo

Air humidity45.7 %

Moisture balance-95.2 mm/mo

Vapour deficit827 Pa

Wind speed4.50 m/s

Cloud cover24.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Neverita didyma

At a glance

Sources8 archives

Size & morphology1

Habitat & environment2

Uses & economy1

Other traits3

At a glance

Record type3 019 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 019 records