Mimetus puritanus

Chamberlin, 1923 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Mimetidae/Mimetus

At a glance

Occurrence records420

Data sources9

Biological traits1

DNA specimens32

eDNA detections31

Sources9 archives

Databases and archives Mimetus puritanus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility420 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

World Spider Trait DBMasaryk University1 traits · 1 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF420 records

Environmental DNA1 datasets · 2 countries31 detections

DNA & barcodingBOLD32 specimens

01Narrative

Mimetus puritanus is a species of pirate spider in the family Mimetidae. It is found in the United States.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPekár et al. 2012a

Predation1

Prey diversity1.86 mm

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mimetus puritanus has left across the world's sequence archives.

At a glance

DNA specimens32

BINs1

Marker genes1

eDNA detections31

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

28Amostly conserved

49Amostly conserved

73Amostly conserved

88Amostly conserved

103Tmostly conserved

127Cmostly conserved

160Gmostly conserved

163Gvariable

181Tmostly conserved

187Tmostly conserved

212Cvariable

220Tmostly conserved

241Gmostly conserved

271Cmostly conserved

313Avariable

316Gmostly conserved

361Gmostly conserved

373Amostly conserved

400Tvariable

407Tmostly conserved

448Cvariable

469Tmostly conserved

472Gmostly conserved

496Tmostly conserved

578Tmostly conserved

619Avariable

TACTTTATATTTGGTTTTTGGGGCTTGATCAGCTATGGTAGGGACTGCAATAAGTGTATTGATTCGAAGTGAACTTGGGCAAGCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes10

BIN1

Most divergent pair2.3%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mimetus epeiroidessame genus7.9%Mimetus hesperussame genus8.0%Mimetus notiussame genus13.2%Mimetus syllepsicussame genus13.2%Sisicottus montanussame order14.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type420 records

Wild obs. + sensor329

Museum / vouchered91

Range

Area of Occupancy AOO1 284 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 139≤1 km 66≤10 km 17>10 km 67

289 georeferenced · 40 without coordinates

Open the mapobservation + sensor329

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 1≤1 km 3≤10 km 11

15 georeferenced · 76 without coordinates

Open the institutions mapphysical evidence91

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ohio State University Acarology Laboratorylocation not on record	28
Chicago, US	13
Cambridge, US	10
University of Guelph, Centre for Biodiversity Genomicslocation not on record	8
Denver, US	6
Champaign, US	4
University Park, US	3
Albuquerque, US	2
Royal Ontario Museumlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

10 institutions · 76 of 91 vouchered records shown · 15 without an institution code

09Environmental DNA31 detections

Where the DNA of Mimetus puritanus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found31

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 31 detections have coordinates

Open the map2 countries0

GrasslandMixed habitatForestBeachgoldenroddogwood or oak

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.1 °C 12.9–23.5

Seasonal swing summer↔winter27.0 °C

Max temp (day)24.2 °C 17.2–27.8

Min temp (night)17.8 °C 8.90–19.9

Precipitation93.3 mm/mo 80.1–98.1

Air humidity58.0 % 56.8–59.3

Moisture balance-65.8 mm/mo -97.2–-29.7

Vapour deficit1,063 Pa 643–1,218

Wind speed3.40 m/s 2.90–6.10

Cloud cover39.5 % 36.1–46.5

CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)