Mimetus hesperus

Chamberlin, 1923 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Mimetidae/Mimetus

At a glance

Occurrence records78

Data sources8

Biological traits0

DNA specimens34

eDNA detections35

Sources8 archives

Databases and archives Mimetus hesperus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility78 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF78 records

Environmental DNA1 datasets · 2 countries35 detections

DNA & barcodingBOLD34 specimens

01Narrative

Mimetus hesperus is a species of pirate spider in the family Mimetidae. It is found in the United States.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mimetus hesperus has left across the world's sequence archives.

At a glance

DNA specimens34

BINs1

Marker genes1

eDNA detections35

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P564 bp consensus33 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

43Amostly conserved

187Avariable

211Tmostly conserved

295Avariable

352Avariable

406Gvariable

463Tvariable

514Tmostly conserved

520Gmostly conserved

TTTAGTTTTTGGTGCTTGATCAGCTATGGTAGGGACTGCTATAAGAGTGTTAATTCGAACTGAACTTGGACAAGCTGGATCTTTTTTAGG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.67%

Haplotypes15

BIN1

Most divergent pair1.8%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mimetus epeiroidessame genus7.6%Mimetus puritanussame genus8.0%Trichonephila sexpunctatasame order11.7%Trichonephila senegalensissame order11.7%Achaearanea maricaoensissame order13.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type78 records

Wild obs. + sensor13

Museum / vouchered64

Other1

Origin

Native1

Range

Area of Occupancy AOO248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 8≤1 km 4>10 km 1

13 georeferenced

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 6≤1 km 2≤10 km 6>10 km 2

16 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence64

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	28
Albuquerque, US	21
Awka, NG	5
San Diego, US	2
Cambridge, US	2
Ohio State University Acarology Laboratorylocation not on record	1
Mexico City, MX	1
Chicago, US	1
Chicago, US	1
Los Angeles, US	1
Champaign, US	1

11 institutions · 64 of 64 vouchered records shown

09Environmental DNA35 detections

Where the DNA of Mimetus hesperus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found35

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 35 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.4. Temperate Forest3. Shrubland|3.8. Mediterranean-type Shrubby…Chaparral1. Forest & Woodland | 1.4. Temperate Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 7.60–18.2

Seasonal swing summer↔winter9.80 °C

Max temp (day)20.7 °C 13.2–25.9

Min temp (night)11.7 °C 1.60–13.6

Precipitation20.1 mm/mo 2.70–37.7

Air humidity59.9 % 55.1–62.1

Moisture balance-90.3 mm/mo

Vapour deficit659 Pa 466–858

Wind speed1.90 m/s

Cloud cover33.3 % 17.2–51.0

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)