Mimetus epeiroides

Emerton, 1882 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Mimetidae/Mimetus

At a glance

Occurrence records54

Data sources8

Biological traits0

DNA specimens11

eDNA detections10

Sources8 archives

Databases and archives Mimetus epeiroides's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility54 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF54 records

Environmental DNA1 datasets · 2 countries10 detections

DNA & barcodingBOLD11 specimens

01Narrative

Mimetus epeiroides is a species of pirate spider in the family Mimetidae. It is found in the United States.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mimetus epeiroides has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections10

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P646 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

ACTTTATATTTGGTTTTTGGAGCTTGATCAGCTATGGTAGGAACTGCTATAAGTGTATTGATTCGGACTGAGCTTGGGCAAGCTGGTTCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mimetus hesperussame genus7.6%Mimetus puritanussame genus7.9%Mimetus notiussame genus12.2%Mimetus syllepsicussame genus12.7%Laminacauda diffusasame order13.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type54 records

Wild obs. + sensor17

Museum / vouchered37

Range

Area of Occupancy AOO160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 13≤1 km 1>10 km 2

16 georeferenced · 1 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 2≤1 km 2≤10 km 7

11 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence37

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Denver, US	10
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
Royal Saskatchewan Museumlocation not on record	3
Natural History Museum of Utahlocation not on record	2
Chicago, US	2
Biodiversity Institute of Ontariolocation not on record	1
WIlocation not on record	1
Cambridge, US	1
Albuquerque, US	1
Centre for Biodiversity Genomicslocation not on record	1
SOVTlocation not on record	1
Champaign, US	1

12 institutions · 29 of 37 vouchered records shown · 8 without an institution code

09Environmental DNA10 detections

Where the DNA of Mimetus epeiroides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

4. Native Grassland | 4.4. Temperate Grassland4. Native GrasslandWetland5. Wetlands (inland)

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 10.5–19.5

Seasonal swing summer↔winter26.1 °C

Max temp (day)20.9 °C 16.3–26.4

Min temp (night)10.5 °C 4.40–14.1

Precipitation63.4 mm/mo 35.2–86.1

Air humidity55.5 % 52.3–57.1

Moisture balance-65.5 mm/mo -114–-34.0

Vapour deficit762 Pa 555–1,091

Wind speed3.80 m/s 2.30–5.20

Cloud cover42.5 % 36.0–49.8

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)