Mimetus notius

Chamberlin, 1923 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Mimetidae/Mimetus

At a glance

Occurrence records112

Data sources8

Biological traits3

DNA specimens54

eDNA detections53

Sources8 archives

Databases and archives Mimetus notius's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility112 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI53 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics54 specimens↗

World Spider Trait DBMasaryk University3 traits · 2 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources3 traits

Occurrence & distributionGBIF112 records

Environmental DNA1 datasets · 2 countries53 detections

DNA & barcodingBOLD54 specimens

01Narrative

Mimetus notius is a species of pirate spiders in the family Mimetidae. It is found in the USA.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPekár 2014aPekár et al. 2012a

Predation1

Prey diversity2.89 mm

Ecology1

Circadian activitynocturnal

Defence1

Primary defenceCrypsis

05DNA & barcoding54 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Mimetus notius has left across the world's sequence archives.

At a glance

DNA specimens54

BINs1

Marker genes1

eDNA detections53

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus41 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

40Tmostly conserved

67Gmostly conserved

244Amostly conserved

271Tmostly conserved

433Gmostly conserved

496Tmostly conserved

574Amostly conserved

GACTTTATATTTGGTTTTTGGAGCTTGGGCTGCTATGGTTGGGACGGCTATAAGAGTATTAATTCGGACAGAGCTTGGTCAGGCAGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.90%

Haplotypes5

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Mimetus haynesisame genus6.7%Mimetus syllepsicussame genus9.6%Mimetus epeiroidessame genus12.2%Mimetus puritanussame genus13.2%Mimetus laevigatussame genus13.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type112 records

Wild obs. + sensor15

Museum / vouchered97

Range

Area of Occupancy AOO292 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy55% within 1 km

≤100 m 5≤1 km 1≤10 km 1>10 km 4

11 georeferenced · 4 without coordinates

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 1≤1 km 5≤10 km 9>10 km 2

17 georeferenced · 80 without coordinates

Open the institutions mapphysical evidence97

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	18
Cambridge, US	12
Denver, US	7
Royal Ontario Museumlocation not on record	7
Chicago, US	7
Champaign, US	4
Albuquerque, US	3
Centre for Biodiversity Genomicslocation not on record	2
Biodiversity Institute of Ontariolocation not on record	1
Ohio State University Acarology Laboratorylocation not on record	1

10 institutions · 62 of 97 vouchered records shown · 35 without an institution code

09Environmental DNA53 detections

Where the DNA of Mimetus notius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found53

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 53 detections have coordinates

Open the map2 countries0

1. Forest & WoodlandTemperate mixed forestRiparian ZoneMixed Habitatbeating on the bushesForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.6 °C 7.40–28.2

Seasonal swing summer↔winter26.4 °C

Max temp (day)20.8 °C 12.2–33.2

Min temp (night)14.2 °C 3.20–24.5

Precipitation87.9 mm/mo 79.7–114

Air humidity60.0 % 56.0–61.1

Moisture balance-27.3 mm/mo -65.1–11.8

Vapour deficit761 Pa 442–1,491

Wind speed2.90 m/s 2.60–4.30

Cloud cover45.1 % 22.7–51.5

CHELSA 1981–2010, ~9 km grid, at location & month of 52 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)