Metarranthis warneri

(Harvey, 1874) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Metarranthis

At a glance

Occurrence records78

Data sources8

Biological traits0

DNA specimens7

eDNA detections5

Sources8 archives

Databases and archives Metarranthis warneri's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility78 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF78 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD7 specimens

01Narrative

Metarranthis warneri, or Warner's metarranthis, is a species of geometrid moth in the family Geometridae. It is found in North America. The MONA or Hodges number for Metarranthis warneri is 6821.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Metarranthis warneri has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes1

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Diversity (π)2.7%

Haplotypes2

BINs2

Most divergent pair5.3%

Where individuals differ — all 35 variable positions, in barcode order

19Tmostly conserved

22Amostly conserved

25Tmostly conserved

34Amostly conserved

61Gmostly conserved

88Gmostly conserved

133Cmostly conserved

136Tmostly conserved

205Cmostly conserved

211Amostly conserved

217Amostly conserved

220Tmostly conserved

226Tmostly conserved

235Tmostly conserved

244Amostly conserved

268Gmostly conserved

286Amostly conserved

316Amostly conserved

325Tmostly conserved

337Amostly conserved

347Cmostly conserved

352Amostly conserved

364Tmostly conserved

418Tmostly conserved

428Cmostly conserved

433Gmostly conserved

463Cmostly conserved

475Cmostly conserved

514Amostly conserved

517Amostly conserved

533Tmostly conserved

616Cmostly conserved

619Tmostly conserved

622Tmostly conserved

628Amostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCTTTAAGATTATTGATTCGAGCTGAATTAGGAAATCCTGGGTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Metarranthis amyrisariasame genus4.6%Metarranthis angulariasame genus4.7%Metarranthis duariasame genus5.5%Metarranthis obfirmariasame genus7.0%Allochrostes saliatasame family7.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type78 records

Wild obs. + sensor16

Museum / vouchered62

Range

Area of Occupancy AOO200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 7≤1 km 1≤10 km 2>10 km 1

11 georeferenced · 5 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 12≤1 km 6≤10 km 20>10 km 5

43 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence62

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	19
Washington, US	15
Colorado State Universitylocation not on record	12
East Lansing, US	9
Cambridge, US	2
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1

7 institutions · 60 of 62 vouchered records shown · 2 without an institution code

09Environmental DNA5 detections

Where the DNA of Metarranthis warneri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 3.30–18.7

Seasonal swing summer↔winter28.4 °C

Max temp (day)20.9 °C 7.80–23.5

Min temp (night)10.6 °C -1.10–14.2

Precipitation105 mm/mo 86.6–114

Air humidity59.2 % 56.1–61.0

Moisture balance-20.2 mm/mo -34.7–32.2

Vapour deficit747 Pa 375–841

Wind speed2.70 m/s 1.80–4.50

Cloud cover46.8 % 43.8–55.3

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)