Metarranthis angularia

Barnes & McDunnough, 1917 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Metarranthis

At a glance

Occurrence records620

Data sources7

Biological traits0

DNA specimens51

eDNA detections45

Sources7 archives

Databases and archives Metarranthis angularia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility620 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI45 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics51 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF620 records

Environmental DNA1 datasets · 1 countries45 detections

DNA & barcodingBOLD51 specimens

01Narrative

Metarranthis angularia, the angled metarranthis moth, is a species of moth in the family Geometridae. It was first described by William Barnes and James Halliday McDunnough in 1917 and it is found in North America. The MONA or Hodges number for Metarranthis angularia is 6823.Pohl, G.R., Patterson, B., & Pelham, J.P. (2016). Taxonomic Checklist of the Lepidoptera of North America, North of Mexico

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding51 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Metarranthis angularia has left across the world's sequence archives.

At a glance

DNA specimens51

BINs5

Marker genes1

eDNA detections45

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus50 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 32 variable positions, in barcode order

22Gmostly conserved

38Gmostly conserved

91Amostly conserved

181Cvariable

197Tmostly conserved

209Amostly conserved

217Gvariable

229Gmostly conserved

253Gvariable

268Amostly conserved

271Cmostly conserved

316Amostly conserved

337Cmostly conserved

352Avariable

370Gmostly conserved

373Cmostly conserved

403Amostly conserved

424Gvariable

433Amostly conserved

499Cmostly conserved

508Avariable

514Gvariable

517Gvariable

526Tmostly conserved

550Amostly conserved

557Tmostly conserved

562Amostly conserved

589Tmostly conserved

607Tmostly conserved

619Tmostly conserved

628Tmostly conserved

646Cmostly conserved

AACATTATATTTTATTTTTGGGATCTGAGCAGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes21

BINs5

Most divergent pair5.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Metarranthis amyrisariasame genus3.2%Metarranthis duariasame genus4.0%Metarranthis warnerisame genus4.7%Metarranthis obfirmariasame genus5.5%Racotis boarmiariasame family7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type620 records

Wild obs. + sensor236

Museum / vouchered384

Range

Area of Occupancy AOO1 160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 103≤1 km 44≤10 km 14>10 km 13

174 georeferenced · 62 without coordinates

Open the mapobservation + sensor236

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 5≤1 km 74≤10 km 192>10 km 7

278 georeferenced · 106 without coordinates

Open the institutions mapphysical evidence384

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	191
Cambridge, US	109
Washington, US	19
Mississippi State, US	19
CUlocation not on record	14
OSUClocation not on record	9
East Lansing, US	8
Colorado State Universitylocation not on record	5
ASUlocation not on record	2
Blacksburg, US	1

10 institutions · 377 of 384 vouchered records shown · 7 without an institution code

09Environmental DNA45 detections

Where the DNA of Metarranthis angularia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found45

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 45 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.7 °C 15.2–25.3

Seasonal swing summer↔winter20.7 °C

Max temp (day)25.2 °C 16.8–30.6

Min temp (night)15.8 °C 10.3–20.9

Precipitation117 mm/mo 99.1–130

Air humidity59.7 % 58.2–61.6

Moisture balance-32.5 mm/mo

Vapour deficit980 Pa 601–1,285

Wind speed2.20 m/s

Cloud cover36.7 % 28.2–39.4

CHELSA 1981–2010, ~9 km grid, at location & month of 40 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)