Metarranthis obfirmaria

(Hübner, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Metarranthis

At a glance

Occurrence records1 068

Data sources7

Biological traits0

DNA specimens20

eDNA detections19

Sources7 archives

Databases and archives Metarranthis obfirmaria's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 068 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 068 records

Environmental DNA1 datasets · 2 countries19 detections

DNA & barcodingBOLD20 specimens

01Narrative

Metarranthis obfirmaria, the yellow-washed metarranthis, is a moth of the family Geometridae. It is found in eastern North America, from Nova Scotia and southern Canada to Georgia, west to Kansas. The wingspan is 26–36 mm. Adults are on wing from late April to July. The larvae feed on Vaccinium, Prunus and Quercus species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Metarranthis obfirmaria has left across the world's sequence archives.

At a glance

DNA specimens20

BINs2

Marker genes1

eDNA detections19

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 68 variable positions, in barcode order

25Cmostly conserved

29Tmostly conserved

40Amostly conserved

46Cmostly conserved

56Cmostly conserved

58Tmostly conserved

79Tmostly conserved

88Amostly conserved

92Tvariable

133Tmostly conserved

169Tmostly conserved

190Gmostly conserved

202Gmostly conserved

211Amostly conserved

212Cmostly conserved

214Tmostly conserved

217Amostly conserved

220Cmostly conserved

232Amostly conserved

235Tmostly conserved

238Amostly conserved

241Tmostly conserved

247Cmostly conserved

266Cmostly conserved

268Amostly conserved

271Cmostly conserved

284Cmostly conserved

286Tmostly conserved

295Amostly conserved

313Cvariable

316Tmostly conserved

319Cmostly conserved

337Cmostly conserved

340Tmostly conserved

352Tmostly conserved

355Tmostly conserved

370Gmostly conserved

376Amostly conserved

379Amostly conserved

391Amostly conserved

400Cmostly conserved

412Tmostly conserved

442Tmostly conserved

469Amostly conserved

499Cmostly conserved

505Cmostly conserved

506Gmostly conserved

508Amostly conserved

512Tmostly conserved

514Amostly conserved

517Gmostly conserved

520Amostly conserved

526Tmostly conserved

532Tmostly conserved

542Tmostly conserved

544Amostly conserved

556Amostly conserved

568Tmostly conserved

574Cmostly conserved

577Gvariable

586Amostly conserved

604Amostly conserved

607Tmostly conserved

610Tmostly conserved

616Tmostly conserved

619Tmostly conserved

628Tmostly conserved

637Amostly conserved

AACATTATATTTTATTTTTGGAATCTGATCAGGAATAGTAGGAACCTCTTTAAGACTTTTAATTCGAGCTGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes6

BINs2

Most divergent pair1.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Metarranthis angulariasame genus5.5%Metarranthis amyrisariasame genus6.1%Metarranthis duariasame genus6.5%Metarranthis warnerisame genus7.0%Calamodes subscudulariasame family7.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 068 records

Wild obs. + sensor783

Museum / vouchered285

Range

Area of Occupancy AOO2 404 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 381≤1 km 134≤10 km 55>10 km 43

613 georeferenced · 170 without coordinates

Open the mapobservation + sensor783

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy19% within 1 km

≤100 m 4≤1 km 39≤10 km 158>10 km 24

225 georeferenced · 60 without coordinates

Open the institutions mapphysical evidence285

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	133
East Lansing, US	37
Cambridge, US	36
Colorado State Universitylocation not on record	15
Cleveland Museum of Natural History, OH (CLEV)location not on record	11
Philadelphia, US	10
Cornell University Insect Collectionlocation not on record	5
CUlocation not on record	4
Denver, US	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Washington, US	4
OSUClocation not on record	3
Blacksburg, US	3
Toronto, CA	2
UDlocation not on record	2
St. Paul, US	2
Natural History Museum of Utahlocation not on record	1
Mississippi State, US	1

18 institutions · 277 of 285 vouchered records shown · 8 without an institution code

09Environmental DNA19 detections

Where the DNA of Metarranthis obfirmaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map2 countries0

Wetland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.1 °C 12.7–18.5

Seasonal swing summer↔winter20.1 °C

Max temp (day)18.6 °C 16.4–23.9

Min temp (night)12.1 °C 8.60–15.3

Precipitation108 mm/mo 90.5–124

Air humidity60.2 % 55.2–60.9

Moisture balance-14.0 mm/mo -43.6–13.8

Vapour deficit713 Pa 619–873

Wind speed3.50 m/s 2.40–5.20

Cloud cover43.6 % 37.3–54.7

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Metarranthis obfirmaria

At a glance

Sources7 archives

At a glance

Record type1 068 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 18 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 068 records