Metarranthis duaria

(Guenée) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Geometridae/Metarranthis

At a glance

Occurrence records1 418

Data sources7

Biological traits0

DNA specimens75

eDNA detections89

Sources7 archives

Databases and archives Metarranthis duaria's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 418 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI89 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics75 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 418 records

Environmental DNA1 datasets · 2 countries89 detections

DNA & barcodingBOLD75 specimens

01Narrative

Metarranthis duaria, the ruddy metarranthis, is a species of geometrid moth in the family Geometridae. It is found in North America. The MONA or Hodges number for Metarranthis duaria is 6822.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding75 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Metarranthis duaria has left across the world's sequence archives.

At a glance

DNA specimens75

BINs1

Marker genes1

eDNA detections89

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus73 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

22Gmostly conserved

37Avariable

166Amostly conserved

286Cmostly conserved

370Gmostly conserved

517Gvariable

562Amostly conserved

619Gmostly conserved

AACATTATATTTTATTTTCGGGATCTGAGCAGGTATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.69%

Haplotypes29

BIN1

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Metarranthis angulariasame genus4.0%Metarranthis amyrisariasame genus5.5%Metarranthis warnerisame genus5.5%Metarranthis obfirmariasame genus6.5%Thallophaga nigroseriatasame family7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 418 records

Wild obs. + sensor592

Museum / vouchered826

Range

Area of Occupancy AOO2 596 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 350≤1 km 75≤10 km 28>10 km 29

482 georeferenced · 110 without coordinates

Open the mapobservation + sensor592

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 12≤1 km 98≤10 km 269>10 km 49

428 georeferenced · 398 without coordinates

Open the institutions mapphysical evidence826

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	190
Cambridge, US	182
University of Alberta Museums (UAM)location not on record	167
East Lansing, US	97
Royal Saskatchewan Museumlocation not on record	35
Washington, US	33
University of Guelph, Centre for Biodiversity Genomicslocation not on record	27
Colorado State Universitylocation not on record	13
Cleveland Museum of Natural History, OH (CLEV)location not on record	8
Philadelphia, US	7
OSUClocation not on record	4
Mississippi State, US	3
Cornell University Insect Collectionlocation not on record	3
Vernal, US	2
UDlocation not on record	2
CUlocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

17 institutions · 775 of 826 vouchered records shown · 51 without an institution code

09Environmental DNA89 detections

Where the DNA of Metarranthis duaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found89

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 89 detections have coordinates

Open the map2 countries0

Temperate mixed forestGrasslandMixed habitatalvar/savannah, UV lightManaged scrubUV light

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.1 °C 11.2–21.7

Seasonal swing summer↔winter27.7 °C

Max temp (day)20.2 °C 14.2–24.2

Min temp (night)10.7 °C 7.80–19.9

Precipitation88.4 mm/mo 65.5–106

Air humidity58.0 % 52.9–62.5

Moisture balance-49.8 mm/mo -97.2–47.8

Vapour deficit709 Pa 528–1,086

Wind speed3.20 m/s 2.20–6.10

Cloud cover42.4 % 38.0–48.1

CHELSA 1981–2010, ~9 km grid, at location & month of 86 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Metarranthis duaria

At a glance

Sources7 archives

At a glance

Record type1 418 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 418 records