Ianthella basta

(Pallas, 1766) · species

image placeholder — illustration coming later

Animalia/Porifera/Demospongiae/Verongiida/Ianthellidae/Ianthella

At a glance

Occurrence records701

Data sources12

Biological traits4

DNA specimens59

eDNA detections64

Sources12 archives

Databases and archives Ianthella basta's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility390 records↗

OBISOcean Biodiversity Information System311 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI64 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics59 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Chemical compositionLOTUS · NPASS83 compounds

Occurrence & distributionGBIF · OBIS701 records

Environmental DNA1 datasets · 0 countries64 detections

DNA & barcodingBOLD59 specimens

Genome at a glanceGoaT · NCBI≈209 Mbp

01Narrative

Ianthella basta is a species of fan-shaped sea sponge in the class Demospongiae. It is also known as the elephant ear sponge, paper sponge, or scroll sponge.Saltcorner A sponge measuring 1.7 m in height and 9.5 m circumference has been estimated to be about 8 years old.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

Other traits2

Depth max100 m

Depth min0 m

03Chemical composition83 compounds

Compounds documented for Ianthella basta across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cinnamic acid amides2

Cholestane steroids $ Pregnane steroids2

Cholestane steroids2

Cholane steroids1

Pregnane steroids1

Documented compounds83 total

Tissue Source Quantified only

Compound	Amount	Source
(12E,25E)-16,21,32,36-tetrabromo-4,20-dihydroxy-12,25-bis(hydroxyimino)-2,18-dioxa-10,27-diazapentacyclo[28.2.2.214,17.13,7.119,23]octatriaconta-1(32),3,5,7(38),14,16,19,21,23(35),30,33,36-dodecaene-11,26-dione	present	LOTUS
(12E,25E)-5,16,21,32-tetrabromo-4,17-dihydroxy-12,25-bis(hydroxyimino)-2,19-dioxa-10,27-diazapentacyclo[28.2.2.220,23.13,7.114,18]octatriaconta-1(32),3,5,7(38),14(37),15,17,20,22,30,33,35-dodecaene-11,26-dione	present	LOTUS
(12E,25E,28E)-16,21,32,36-tetrabromo-4,20-dihydroxy-12,25-bis(hydroxyimino)-2,18-dioxa-10,27-diazapentacyclo[28.2.2.214,17.13,7.119,23]octatriaconta-1(32),3,5,7(38),14,16,19,21,23(35),28,30,33,36-tridecaene-11,26-dione	present	LOTUS
(12E,25E,29R)-5,16,21,32,36-pentabromo-4,20,29-trihydroxy-12,25-bis(hydroxyimino)-2,18-dioxa-10,27-diazapentacyclo[28.2.2.214,17.13,7.119,23]octatriaconta-1(32),3,5,7(38),14,16,19,21,23(35),30,33,36-dodecaene-11,26-dione	present	LOTUS
(12E,25Z)-16,21,32,36-tetrabromo-4,17-dihydroxy-12,25-bis(hydroxyimino)-2,19-dioxa-10,27-diazapentacyclo[28.2.2.220,23.13,7.114,18]octatriaconta-1(32),3,5,7(38),14(37),15,17,20(36),21,23(35),30,33-dodecaene-11,26-dione	present	LOTUS
(12E,25Z)-5,16,21,32-Tetrabromo-4,17-dihydroxy-12,25-bis(hydroxyimino)-2,19-dioxa-10,27-diazapentacyclo[28.2.2.220,23.13,7.114,18]octatriaconta-1(32),3,5,7(38),14(37),15,17,20,22,30,33,35-dodecaene-11,26-dione	present	LOTUS
(12E,25Z)-5,16,21,32-tetrabromo-4,20-dihydroxy-12,25-bis(hydroxyimino)-2,18-dioxa-10,27-diazapentacyclo[28.2.2.214,17.13,7.119,23]octatriaconta-1(32),3,5,7(38),14,16,19,21,23(35),30,33,36-dodecaene-11,26-dione	present	LOTUS
(12E,29S)-5,16,21,32,33-pentabromo-4,20,29-trihydroxy-12,25-bis(hydroxyimino)-2,18-dioxa-10,27-diazapentacyclo[28.2.2.214,17.13,7.119,23]octatriaconta-1(32),3,5,7(38),14,16,19,21,23(35),30,33,36-dodecaene-11,26-dione	present	LOTUS
(12E,29S)-5,16,21,32,36-pentabromo-4,20,29-trihydroxy-12,25-bis(hydroxyimino)-2,18-dioxa-10,27-diazapentacyclo[28.2.2.214,17.13,7.119,23]octatriaconta-1(32),3,5,7(38),14,16,19,21,23(35),30,33,36-dodecaene-11,26-dione	present	LOTUS
(12E,29S)-5,16,21,32-tetrabromo-4,20,29-trihydroxy-12,25-bis(hydroxyimino)-2,18-dioxa-10,27-diazapentacyclo[28.2.2.214,17.13,7.119,23]octatriaconta-1(32),3,5,7(38),14,16,19,21,23(35),30,33,36-dodecaene-11,26-dione	present	LOTUS

05DNA & barcoding59 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ianthella basta has left across the world's sequence archives.

At a glance

DNA specimens59

BINs1

Marker genes3

eDNA detections64

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P682 bp consensus48 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

92Cmostly conserved

101Tmostly conserved

323Gmostly conserved

350Cmostly conserved

416Tmostly conserved

464Cmostly conserved

482Amostly conserved

549Cmostly conserved

566Tmostly conserved

632Amostly conserved

638Tmostly conserved

647Tmostly conserved

ATAAAGATATTGGAACTCTTTATTTATTATTTGGAGTTTTCGCAGGTATGATTGGGACGGCTTTTAGTATGTTAATTAGACTGGAGCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.48%

Haplotypes8

BIN1

Most divergent pair2.1%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aplysina archerisame order11.0%Aiolochroia crassasame order11.0%Aplysina cauliformissame order11.1%Aplysina fulvasame order11.4%Aplysina aerophobasame order11.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS218S-5P

animal barcodefungal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Ianthella basta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈209 268 932 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Ianthella basta0.21 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness71.6% BUSCO

08Occurrence & distribution

Record type701 records

Wild obs. + sensor236

Museum / vouchered464

Other1

Range

Area of Occupancy AOO1 100 km²

Depth

0–200 m sunlit62

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 30 m · max 125 m · 62 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 85≤1 km 76≤10 km 10>10 km 17

188 georeferenced · 48 without coordinates

Open the mapobservation + sensor236

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy90% within 1 km

≤100 m 191≤1 km 71≤10 km 22>10 km 8

292 georeferenced · 172 without coordinates

Open the institutions mapphysical evidence464

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natick, US	101
Museum and Art Gallery of the Northern Territorylocation not on record	59
Sydney, AU	27
Western Australian Museumlocation not on record	13
CASlocation not on record	7
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Museums Victorialocation not on record	3
Auckland, NZ	3
Washington, US	2
DEWlocation not on record	2
WoRMS Editorial Boardlocation not on record	1
South Kensington, GB	1

12 institutions · 222 of 464 vouchered records shown

09Environmental DNA64 detections

Where the DNA of Ianthella basta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found64

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 64 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)