Aplysina cauliformis

(Carter, 1882) · species

image placeholder — illustration coming later

Animalia/Porifera/Demospongiae/Verongiida/Aplysinidae/Aplysina

At a glance

Occurrence records1 224

Data sources12

Biological traits6

DNA specimens23

eDNA detections4

Sources12 archives

Databases and archives Aplysina cauliformis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 005 records↗

OBISOcean Biodiversity Information System219 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Chemical compositionLOTUS · NPASS197 compounds

Occurrence & distributionGBIF · OBIS1 224 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD23 specimens

Genome at a glanceGoaT · NCBI≈198 Mbp

01Narrative

Aplysina cauliformis is een sponssoort in de taxonomische indeling van de gewone sponzen (Demospongiae). Het lichaam van de spons bestaat uit kiezelnaalden en sponginevezels, en is in staat om veel water op te nemen. De spons behoort tot het geslacht Aplysina en behoort tot de familie Aplysinidae. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1882 door Carter.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length60 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

Other traits3

Depth max20 m

Depth min2 m

Vulnerability44

03Chemical composition197 compounds

Compounds documented for Aplysina cauliformis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Quassinoids69

Carboline alkaloids10

Flavones5

Apotirucallane triterpenoids3

Imidazole alkaloids3

Documented compounds197 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Pinoresinol	present	NPASS
(-)-Hydnocarpin	present	NPASS
(11beta,12alpha,15beta)-13,20-Epoxy-3,11,12-trihydroxy-15-[[(2E)-4-hydroxy-3,4-dimethyl-1-oxo-2-penten-1-yl]oxy]-2,16-dioxopicras-3-en-21-oic acid	present	NPASS
(1beta,2alpha,11beta,12alpha,15beta)-13,20-Epoxy-1,2,11,12,14,15-hexahydroxypicras-3-en-16-one	present	NPASS
(1R,2R)-1-(4-hydroxy-3-methoxyphenyl)-2-[2-[(E)-3-hydroxyprop-1-enyl]-3-methoxyphenoxy]propane-1,3-diol	present	NPASS
(1R,2R,3R,6R,8S,11S,12S,13S,14R,15R,16S,17R)-2,3,11,12,15,16-hexahydroxy-17-(hydroxymethyl)-9,13-dimethyl-5,18-dioxapentacyclo[12.5.0.01,6.02,17.08,13]nonadec-9-en-4-one	present	NPASS
(1R,2R,3R,6R,8S,11S,12S,13S,14R,15R,16S,17R)-2,3,12,15,16-pentahydroxy-9,13,17-trimethyl-11-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-5,18-dioxapentacyclo[12.5.0.01,6.02,17.08,13]nonadec-9-en-4-one	present	NPASS
(1R,2R,3R,6R,8S,12S,13S,14R,15R,16S,17R,19S)-2,3,12,15,16,17,19-heptahydroxy-9,13-dimethyl-5,18-dioxapentacyclo[12.5.0.01,6.02,17.08,13]nonadec-9-ene-4,11-dione	present	NPASS
(1R,2R,3R,6R,8S,12S,13S,14R,15R,16S,17R,19S)-2,3,12,15,16,19-hexahydroxy-9,13,17-trimethyl-5,18-dioxapentacyclo[12.5.0.01,6.02,17.08,13]nonadec-9-ene-4,11-dione	present	NPASS
(1R,2R,3R,6R,8S,9R,10R,11S,12R)-2,3,10,11-tetrahydroxy-8,12-dimethyl-8-[(2R)-3-methyl-5-oxo-2H-furan-2-yl]-5,13-dioxatetracyclo[7.5.0.01,6.02,12]tetradecan-4-one	present	NPASS

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aplysina cauliformis has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes13

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P568 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

436Gmostly conserved

450Amostly conserved

526Gmostly conserved

553Gmostly conserved

560Amostly conserved

564Tmostly conserved

566Amostly conserved

567Cmostly conserved

568Amostly conserved

ATGATAGGAACAGCATTTAGTATGTTAATTAGACTGGAGTTATCTGCACCAGGCTCAATGTTAGGAGACGATCATTTATATAATGTTATA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.38%

Haplotypes3

BIN1

Most divergent pair1.6%

OtherS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aiolochroia crassasame family7.2%Verongula rigidasame family9.0%Suberea ianthelliformissame order9.2%Pseudoceratina purpureasame order9.7%Ianthella bastasame order11.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS218S-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodefungal barcoderibosomalmitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_016949 ↗ · 14 protein · 25 tRNA · 2 rRNA

ND4LND3ND6ND4ATP9CYTBND1COX1COX2ATP8ATP6COX3ND2ND5rnLrnS

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aplysina cauliformis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈197 672 554 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Aplysina cauliformis0.20 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness82.9% BUSCO

08Occurrence & distribution

Record type1 224 records

Wild obs. + sensor1 099

Museum / vouchered125

Origin

Native1

Range

Area of Occupancy AOO1 488 km²

Depth

0–200 m sunlit203

200–1000 m twilight2

1–4 km midnight0

>4 km abyssal0

median 18 m · max 270 m · 205 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 358≤1 km 173≤10 km 70>10 km 36

637 georeferenced · 462 without coordinates

Open the mapobservation + sensor1 099

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 33≤10 km 3>10 km 1

37 georeferenced · 88 without coordinates

Open the institutions mapphysical evidence125

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	14
Washington, US	13
Instituto de Investigaciones Marinas y Costeras (INVEMAR)location not on record	11
UM-RSMASlocation not on record	7
Masindi, UG	5
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	4
New Haven, US	3
WoRMS Editorial Boardlocation not on record	3
Moscow State Universitylocation not on record	2
CASlocation not on record	2
Universidad del Magdalena (UniMagdalena)location not on record	2
Auckland, NZ	2
Universidad El Bosque (El Bosque)location not on record	1
Texas Cooperative Wildlife Collectionlocation not on record	1
RMNHlocation not on record	1

15 institutions · 71 of 125 vouchered records shown · 12 without an institution code

09Environmental DNA4 detections

Where the DNA of Aplysina cauliformis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter3.10 °C

Max temp (day)25.7 °C

Min temp (night)24.4 °C

Precipitation57.6 mm/mo

Air humidity59.7 %

Vapour deficit1,274 Pa

Cloud cover22.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aplysina cauliformis

At a glance

Sources12 archives

Size & morphology1

Habitat & environment2

Other traits3

Compound class profile5 classes

Documented compounds197 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 224 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 224 records