Aiolochroia crassa

(Hyatt, 1875) · species

image placeholder — illustration coming later

Animalia/Porifera/Demospongiae/Verongiida/Aplysinidae/Aiolochroia

At a glance

Occurrence records2 407

Data sources11

Biological traits5

DNA specimens39

eDNA detections42

Sources11 archives

Databases and archives Aiolochroia crassa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 970 records↗

OBISOcean Biodiversity Information System437 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI42 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics39 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Chemical compositionLOTUS19 compounds

Occurrence & distributionGBIF · OBIS2 407 records

Environmental DNA2 datasets · 7 countries42 detections

DNA & barcodingBOLD39 specimens

Genome at a glanceGoaT · NCBI245 Mbp

01Narrative

Aiolochroia crassa is een sponssoort in de taxonomische indeling van de gewone sponzen (Demospongiae). Het lichaam van de spons bestaat uit kiezelnaalden en sponginevezels, en is in staat om veel water op te nemen. De spons behoort tot het geslacht Aiolochroia en behoort tot de familie Aplysinidae. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1875 door Hyatt.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonesessile

Other traits2

Depth max52 m

Depth min3 m

03Chemical composition19 compounds

Compounds documented for Aiolochroia crassa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Imidazole alkaloids4

Cholestane steroids3

Polyamines1

Documented compounds19 total

Tissue Source Quantified only

Compound	Amount	Source
(12E,25Z)-16,21,32,36-tetrabromo-4,17-dihydroxy-12,25-bis(hydroxyimino)-2,19-dioxa-10,27-diazapentacyclo[28.2.2.220,23.13,7.114,18]octatriaconta-1(32),3,5,7(38),14(37),15,17,20(36),21,23(35),30,33-dodecaene-11,26-dione	present	LOTUS
(2E)-3-[3-bromo-5-[2,6-dibromo-4-[(2E)-3-[2-(3-bromo-4-hydroxyphenyl)ethylamino]-2-hydroxyimino-3-oxopropyl]phenoxy]-4-hydroxyphenyl]-N-[2-(3-bromo-4-hydroxyphenyl)ethyl]-2-hydroxyiminopropanamide	present	LOTUS
(2E)-3-[3-bromo-5-[3-bromo-5-[(2E)-3-[2-(3-bromo-4-hydroxyphenyl)ethylamino]-2-hydroxyimino-3-oxopropyl]-2-hydroxyphenyl]-4-hydroxyphenyl]-N-[2-(3-bromo-4-hydroxyphenyl)ethyl]-2-hydroxyiminopropanamide	present	LOTUS
(2E)-N-[2-(2-amino-1H-imidazol-5-yl)ethyl]-3-(3,5-dibromo-4-methoxyphenyl)-2-hydroxyiminopropanamide	present	LOTUS
(2S)-2-amino-3-[3,5-dibromo-4-[3-[[(5S,6R)-7,9-dibromo-6-hydroxy-8-methoxy-1-oxa-2-azaspiro[4.5]deca-2,7,9-triene-3-carbonyl]amino]propoxy]phenyl]propanoic acid	present	LOTUS
(2S)-4-[2,6-dibromo-4-[2-[[(5S,6R)-7,9-dibromo-6-hydroxy-8-methoxy-1-oxa-2-azaspiro[4.5]deca-2,7,9-triene-3-carbonyl]amino]ethyl]phenoxy]-2-(dimethylamino)butanoic acid	present	LOTUS
(3S,5S,8S,9S,10S,13R,14S,17R)-10,13-dimethyl-17-[(2R)-6-methylheptan-2-yl]-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	LOTUS
(5S,6R)-7,9-dibromo-N-[(2S)-3-[2,6-dibromo-4-[(1R)-2-[[(5S,6R)-7,9-dibromo-6-hydroxy-8-methoxy-1-oxa-2-azaspiro[4.5]deca-2,7,9-triene-3-carbonyl]amino]-1-hydroxyethyl]phenoxy]-2-hydroxypropyl]-6-hydroxy-8-methoxy-1-oxa-2-azaspiro[4.5]deca-2,7,9-triene-3-carboxamide	present	LOTUS
(6R)-6-[(8R,9S,10S,13R,14S,17R)-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-17-yl]-2-methylheptan-1-ol	present	LOTUS
5,16,21,32,33,36-Hexabromo-4,20-dihydroxy-12,25-dinitroso-2,18-dioxa-10,27-diazapentacyclo[28.2.2.214,17.13,7.119,23]octatriaconta-1(32),3,5,7(38),14,16,19,21,23(35),30,33,36-dodecaene-11,26-dione	present	LOTUS

05DNA & barcoding39 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aiolochroia crassa has left across the world's sequence archives.

At a glance

DNA specimens39

BINs1

Marker genes3

eDNA detections42

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus34 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.74%

Haplotypes1

BIN1

Where individuals differ — all 5 variable positions, in barcode order

6Amostly conserved

7Tmostly conserved

8Tmostly conserved

9Tmostly conserved

11Gmostly conserved

TTATTATTTGGAGTCTTTGCTGGTATGATAGGAACAGCATTTAGTATGTTAATTAGACTGGAACTATCTGCACCAGGTTCAATGTTAGGA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aplysina fulvasame family6.9%Aplysina archerisame family7.0%Aplysina cauliformissame family7.2%Chelonaplysilla delicatasame order7.7%Aplysina aerophobasame family7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS218S-5P

animal barcodefungal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aiolochroia crassa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size244 500 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Aiolochroia crassa0.24 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness72.5% BUSCO

08Occurrence & distribution

Record type2 407 records

Wild obs. + sensor2 100

Museum / vouchered307

Range

Area of Occupancy AOO2 252 km²

Depth

0–200 m sunlit359

200–1000 m twilight7

1–4 km midnight0

>4 km abyssal0

median 53.5 m · max 280 m · 366 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 810≤1 km 264≤10 km 82>10 km 57

1 213 georeferenced · 887 without coordinates

Open the mapobservation + sensor2 100

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤1 km 5≤10 km 5>10 km 2

12 georeferenced · 295 without coordinates

Open the institutions mapphysical evidence307

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Masindi, UG	66
Facultad de Ciencias Biológicas y Agropecuarias, Universidad Veracruzana, Región Poza Rica-Tuxpanlocation not on record	41
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	29
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	12
New Haven, US	8
Washington, US	6
Moscow State Universitylocation not on record	6
WoRMS Editorial Boardlocation not on record	4
RMNHlocation not on record	2
Auckland, NZ	1
UM-RSMASlocation not on record	1
CASlocation not on record	1

12 institutions · 177 of 307 vouchered records shown · 46 without an institution code

09Environmental DNA42 detections

Where the DNA of Aiolochroia crassa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found42

Studies independent surveys2

Countries7

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 42 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 25.1–27.5

Seasonal swing summer↔winter3.10 °C

Max temp (day)26.5 °C 25.7–28.2

Min temp (night)25.2 °C 24.4–26.5

Precipitation84.1 mm/mo 13.6–135

Air humidity63.0 % 59.7–64.2

Moisture balance-73.6 mm/mo

Vapour deficit1,276 Pa 1,195–1,370

Wind speed4.40 m/s

Cloud cover20.8 % 12.9–26.4

CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aiolochroia crassa

At a glance

Sources11 archives

Habitat & environment3

Other traits2

Compound class profile3 classes

Documented compounds19 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 407 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 407 records