Aplysina aerophoba

(Nardo, 1833) · species

image placeholder — illustration coming later

Animalia/Porifera/Demospongiae/Verongiida/Aplysinidae/Aplysina

At a glance

Occurrence records4 127

Data sources13

Biological traits2

DNA specimens16

eDNA detections4

Sources13 archives

Databases and archives Aplysina aerophoba's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 854 records↗

OBISOcean Biodiversity Information System273 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionLOTUS · NPASS27 compounds

Occurrence & distributionGBIF · OBIS4 127 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD16 specimens

Genome at a glanceGoaT · NCBI≈159 Mbp

01Narrative

Aplysina aerophoba is a species of sponge in the family Aplysinidae. It is a yellow, tube-forming or encrusting sponge and is native to the eastern Atlantic Ocean and the Mediterranean Sea; the type locality is the Adriatic Sea.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

03Chemical composition27 compounds

Compounds documented for Aplysina aerophoba across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

2-pyrone derivatives4

Imidazole alkaloids3

Linear polyenes1

Branched fatty acids1

Quinolizidine alkaloids1

Documented compounds27 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2R,4R,10S,11R,13S,15R)-15-methyl-6-azatetracyclo[8.6.0.01,6.02,13]hexadecane-4,11-diol	present	NPASS
(3Z)-4,6-dibromo-3-[(E)-but-2-enylidene]-5-hydroxy-1-benzofuran-2-one	present	LOTUS
(5R)-5-[[2,6-dibromo-4-[(5S)-2-oxo-1,3-oxazolidin-5-yl]phenoxy]methyl]-1,3-oxazolidin-2-one	present	LOTUS
(5S)-5-[[2,6-dibromo-4-[(5S)-2-oxo-1,3-oxazolidin-5-yl]phenoxy]methyl]-1,3-oxazolidin-2-one	present	LOTUS
(5S,6R)-7,9-dibromo-N-[(2S)-3-[2,6-dibromo-4-[(1R)-2-[[(5S,6R)-7,9-dibromo-6-hydroxy-8-methoxy-1-oxa-2-azaspiro[4.5]deca-2,7,9-triene-3-carbonyl]amino]-1-hydroxyethyl]phenoxy]-2-hydroxypropyl]-6-hydroxy-8-methoxy-1-oxa-2-azaspiro[4.5]deca-2,7,9-triene-3-carboxamide	present	LOTUS
(5S,6R)-7,9-dibromo-N-[(2S)-3-[2,6-dibromo-4-[(1R)-2-[[(5S,6S)-7,9-dibromo-6-hydroxy-8-methoxy-1-oxa-2-azaspiro[4.5]deca-2,7,9-triene-3-carbonyl]amino]-1-hydroxyethyl]phenoxy]-2-hydroxypropyl]-6-hydroxy-8-methoxy-1-oxa-2-azaspiro[4.5]deca-2,7,9-triene-3-carboxamide	present	LOTUS
11-(5-Carbamoyl-4-oxopyran-2-yl)undeca-8,10-dienoic acid	present	LOTUS
2-(3,5-Dibromo-1-hydroxy-4,4-dimethoxycyclohexa-2,5-dien-1-yl)acetamide	present	LOTUS
3,5,8-Trihydroxy-1H-quinolin-4-one	present	LOTUS
3-(4-Methoxy-3-methyl-6-oxopyran-2-yl)prop-2-enoic acid	present	LOTUS

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aplysina aerophoba has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes3

eDNA detections4

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P619 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.56%

Haplotypes1

BIN1

Where individuals differ — all 11 variable positions, in barcode order

78Gmostly conserved

88Amostly conserved

97Amostly conserved

141Gmostly conserved

299Cvariable

408Tmostly conserved

527Avariable

553Cmostly conserved

559Tmostly conserved

560Tmostly conserved

561Tmostly conserved

GGGTTTTTGCTGGTATGATAGGAACAGCATTTAGTATGTTAATTAGACTGGAGTTATCTGCACCAGGCTCAATGTTAGGAGACGATCATT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aiolochroia crassasame family7.8%Verongula rigidasame family9.1%Suberea ianthelliformissame order9.7%Pseudoceratina purpureasame order11.0%Ianthella bastasame order11.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS218S-5P

animal barcodefungal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Aplysina aerophoba carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈158 787 529 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Aplysina aerophoba0.16 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness67.7% BUSCO

08Occurrence & distribution

Record type4 127 records

Wild obs. + sensor3 772

Museum / vouchered151

Other204

Origin

Native10

Range

Area of Occupancy AOO4 020 km²

Depth

0–200 m sunlit164

200–1000 m twilight2

1–4 km midnight0

>4 km abyssal0

median 10 m · max 423 m · 166 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 976≤1 km 911≤10 km 124>10 km 36

2 047 georeferenced · 1 725 without coordinates

Open the mapobservation + sensor3 772

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced · 148 without coordinates

Open the institutions mapphysical evidence151

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UB_ICMlocation not on record	55
AUTHlocation not on record	35
UCA - SOCIBlocation not on record	6
Cambridge, US	5
WoRMS Editorial Boardlocation not on record	2
South Kensington, GB	2

6 institutions · 105 of 151 vouchered records shown · 9 without an institution code

09Environmental DNA4 detections

Where the DNA of Aplysina aerophoba was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Aplysina aerophoba

At a glance

Sources13 archives

Habitat & environment2

Compound class profile5 classes

Documented compounds27 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type4 127 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 6 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type4 127 records