Diplolepis polita

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Cynipidae/Diplolepis

At a glance

Occurrence records4 153

Data sources5

Biological traits0

DNA specimens27

eDNA detections27

Sources5 archives

Databases and archives Diplolepis polita's data was compiled from.

GBIFGlobal Biodiversity Information Facility4 153 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics27 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF4 153 records

Environmental DNA1 datasets · 2 countries27 detections

DNA & barcodingBOLD27 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding27 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diplolepis polita has left across the world's sequence archives.

At a glance

DNA specimens27

BINs5

Marker genes1

eDNA detections27

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P618 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Diversity (π)1.9%

Haplotypes2

BINs5

Most divergent pair2.8%

Where individuals differ — all 28 variable positions, in barcode order

34Gvariable

67Avariable

79Tvariable

88Gmostly conserved

184Gvariable

190Gvariable

219Cmostly conserved

220Avariable

244Avariable

274Tmostly conserved

289Gvariable

298Tvariable

305Gmostly conserved

355Avariable

361Gmostly conserved

364Gvariable

382Tvariable

415Avariable

433Tvariable

469Tvariable

493Avariable

556Gvariable

565Gvariable

574Tmostly conserved

577Avariable

598Amostly conserved

607Tmostly conserved

616Tmostly conserved

AGTATTATATTTTATATTTGGTATTTGATGTGGGATAGTTGGAGCTGCTTTAAGAATAATTATTCGAATTGAATTAGGTATAACAGGGCA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Diplolepis bassettisame genus1.6%Diplolepis bicolorsame genus5.1%Diplolepis mayrisame genus7.5%Diplolepis rosaesame genus8.3%Diplolepis fusiformanssame genus8.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type4 153 records

Wild obs. + sensor4 128

Museum / vouchered25

Range

Area of Occupancy AOO9 980 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 2 561≤1 km 401≤10 km 166>10 km 186

3 314 georeferenced · 814 without coordinates

Open the mapobservation + sensor4 128

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 5

5 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	5
Chicago, US	4

2 institutions · 9 of 25 vouchered records shown · 16 without an institution code

09Environmental DNA27 detections

Where the DNA of Diplolepis polita was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map2 countries0

4. Native GrasslandForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 6.60–13.4

Seasonal swing summer↔winter14.7 °C

Max temp (day)16.2 °C 11.8–19.1

Min temp (night)7.40 °C 1.80–10.9

Precipitation60.1 mm/mo 29.6–186

Air humidity56.1 % 54.4–68.6

Moisture balance-37.8 mm/mo -67.0–96.1

Vapour deficit497 Pa 412–675

Wind speed2.70 m/s 1.50–5.00

Cloud cover41.9 % 39.0–50.2

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Diplolepis polita

At a glance

Sources5 archives

At a glance

Record type4 153 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions2 of 2 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 153 records