Diplolepis bicolor

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Cynipidae/Diplolepis

At a glance

Occurrence records578

Data sources5

Biological traits0

DNA specimens25

eDNA detections29

Sources5 archives

Databases and archives Diplolepis bicolor's data was compiled from.

GBIFGlobal Biodiversity Information Facility578 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF578 records

Environmental DNA2 datasets · 3 countries29 detections

DNA & barcodingBOLD25 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diplolepis bicolor has left across the world's sequence archives.

At a glance

DNA specimens25

BINs2

Marker genes2

eDNA detections29

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P592 bp consensus24 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

17Tmostly conserved

62Gmostly conserved

161Tvariable

164Gmostly conserved

194Tmostly conserved

243Gvariable

251Amostly conserved

272Tvariable

296Tvariable

305Gvariable

323Amostly conserved

332Tmostly conserved

457Tvariable

464Amostly conserved

468Amostly conserved

485Amostly conserved

530Gvariable

539Amostly conserved

578Amostly conserved

590Tmostly conserved

GATGTGGTATAGTTGGTGCCGCTTTAAGTATAATTATTCGTATTGAATTGGGGATAACAGGGCAATTAATTGGTAATGATCAAATTTATA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes7

BINs2

Most divergent pair3.2%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Diplolepis bassettisame genus5.1%Diplolepis politasame genus5.1%Diplolepis abeisame genus9.0%Diplolepis mayrisame genus9.0%Diplolepis rosaesame genus9.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type578 records

Wild obs. + sensor536

Museum / vouchered42

Range

Area of Occupancy AOO1 796 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 298≤1 km 61≤10 km 16>10 km 53

428 georeferenced · 108 without coordinates

Open the mapobservation + sensor536

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤1 km 11≤10 km 6

17 georeferenced · 25 without coordinates

Open the institutions mapphysical evidence42

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	13
Cornell University Insect Collectionlocation not on record	4
Chicago, US	4
Washington State Department of Agriculturelocation not on record	1

4 institutions · 22 of 42 vouchered records shown · 20 without an institution code

09Environmental DNA29 detections

Where the DNA of Diplolepis bicolor was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys2

Countries3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 8.10–14.1

Seasonal swing summer↔winter23.2 °C

Max temp (day)17.5 °C 14.4–20.2

Min temp (night)6.20 °C 3.30–10.7

Precipitation70.1 mm/mo 37.8–89.3

Air humidity55.2 % 52.1–60.5

Moisture balance-43.8 mm/mo -69.1–7.20

Vapour deficit602 Pa 517–736

Wind speed4.20 m/s 2.60–4.40

Cloud cover38.2 % 36.5–45.5

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)