Diplolepis mayri

(Schlechtendal, 1877) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Cynipidae/Diplolepis

At a glance

Occurrence records2 108

Data sources6

Biological traits0

DNA specimens10

eDNA detections11

Sources6 archives

Databases and archives Diplolepis mayri's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 108 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 108 records

Environmental DNA1 datasets · 1 countries11 detections

DNA & barcodingBOLD10 specimens

01Narrative

Diplolepis mayri est une espèce d'insectes hyménoptères cynipidés qui provoque la formation de galles de l'églantier ressemblant à de petits oursins. L'espèce proche Diplolepis rosae, avec laquelle il ne faut pas la confondre, provoque l'apparition sur les rosiers ou sur les églantiers d'autres galles, les bédégars, qui se présentent sous l'aspect de touffes hirsutes formées de nombreux filaments verdâtres à rougeâtres.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diplolepis mayri has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes2

eDNA detections11

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P597 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Diversity (π)2.6%

Haplotypes2

BINs2

Most divergent pair11.2%

Where individuals differ — all 67 variable positions, in barcode order

15Gmostly conserved

18Gmostly conserved

19Gmostly conserved

27Amostly conserved

36Amostly conserved

39Amostly conserved

54Gmostly conserved

57Amostly conserved

60Tmostly conserved

61Amostly conserved

64Amostly conserved

66Amostly conserved

73Tmostly conserved

75Amostly conserved

103Amostly conserved

129Amostly conserved

144Tmostly conserved

156Amostly conserved

162Gmostly conserved

165Gmostly conserved

180Amostly conserved

204Amostly conserved

222Amostly conserved

234Amostly conserved

250Gmostly conserved

271Amostly conserved

273Tmostly conserved

276Amostly conserved

300Amostly conserved

309Gmostly conserved

312Amostly conserved

315Tmostly conserved

335Tmostly conserved

340Amostly conserved

342Tmostly conserved

360Tmostly conserved

363Tmostly conserved

372Amostly conserved

381Amostly conserved

384Amostly conserved

393Tmostly conserved

402Amostly conserved

405Amostly conserved

411Amostly conserved

417Amostly conserved

432Tmostly conserved

433Amostly conserved

450Tmostly conserved

451Cmostly conserved

456Amostly conserved

457Amostly conserved

462Amostly conserved

464Gmostly conserved

465Amostly conserved

479Cmostly conserved

495Amostly conserved

507Tmostly conserved

510Tmostly conserved

523Tmostly conserved

525Amostly conserved

531Amostly conserved

534Tmostly conserved

537Tmostly conserved

549Tmostly conserved

558Amostly conserved

588Tmostly conserved

597Cmostly conserved

GGTATTTGGTGTGGGATGGTTGGAGCAGCTTTAAGAATAATTATTCGTATTGAGTTAGGTATAACAGGGCAGTTAATTGGTAATGATCAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Diplolepis rosaesame genus2.2%Diplolepis abeisame genus7.4%Diplolepis fusiformanssame genus7.5%Diplolepis politasame genus7.5%Diplolepis rosaefoliisame genus8.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type2 108 records

Wild obs. + sensor2 026

Museum / vouchered82

Range

Area of Occupancy AOO5 192 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 780≤1 km 186≤10 km 494>10 km 24

1 484 georeferenced · 542 without coordinates

Open the mapobservation + sensor2 026

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 2≤1 km 7≤10 km 20>10 km 1

30 georeferenced · 52 without coordinates

Open the institutions mapphysical evidence82

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo Nacional de Ciencias Naturales (CSIC)location not on record	49
Eszterhazy Karoly University of Applied Scienceslocation not on record	12
Champaign, US	7
NMOKlocation not on record	4
SLU Artdatabankenlocation not on record	2
South Kensington, GB	2
Nijmegen, NL	1
Oulu, FI	1
Helsinki, FI	1
neflocation not on record	1

10 institutions · 80 of 82 vouchered records shown · 2 without an institution code

09Environmental DNA11 detections

Where the DNA of Diplolepis mayri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.20 °C 6.20–6.20

Seasonal swing summer↔winter28.2 °C

Max temp (day)10.4 °C

Min temp (night)2.50 °C

Precipitation85.3 mm/mo

Air humidity56.8 %

Moisture balance0.4 mm/mo

Vapour deficit413 Pa

Wind speed4.00 m/s

Cloud cover50.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Diplolepis mayri

At a glance

Sources6 archives

At a glance

Record type2 108 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 108 records