Diplolepis bassetti

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Cynipidae/Diplolepis

At a glance

Occurrence records152

Data sources5

Biological traits0

DNA specimens28

eDNA detections29

Sources5 archives

Databases and archives Diplolepis bassetti's data was compiled from.

GBIFGlobal Biodiversity Information Facility152 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF152 records

Environmental DNA1 datasets · 2 countries29 detections

DNA & barcodingBOLD28 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Diplolepis bassetti has left across the world's sequence archives.

At a glance

DNA specimens28

BINs2

Marker genes1

eDNA detections29

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P617 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.4%

Haplotypes1

BINs2

Where individuals differ — all 16 variable positions, in barcode order

33Gvariable

36Avariable

90Avariable

109Avariable

183Avariable

189Gvariable

288Avariable

297Gvariable

324Avariable

333Avariable

358Avariable

369Avariable

438Tvariable

456Cvariable

462Tvariable

540Avariable

GTATTATACTTTATATTTGGTATTTGATGTGGGATAGTTGGAGCTGCTTTAAGAATAATTATTCGAATTGAATTAGGTATAACAGGGCAA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Diplolepis politasame genus1.6%Diplolepis bicolorsame genus5.1%Diplolepis mayrisame genus8.2%Diplolepis fusiformanssame genus8.8%Diplolepis rosaesame genus8.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type152 records

Wild obs. + sensor103

Museum / vouchered49

Range

Area of Occupancy AOO256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 86≤1 km 1≤10 km 1>10 km 3

91 georeferenced · 12 without coordinates

Open the mapobservation + sensor103

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 16

16 georeferenced · 33 without coordinates

Open the institutions mapphysical evidence49

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	12
Chicago, US	7
Champaign, US	3
ZMAAlocation not on record	2
Natural History Museum of Utahlocation not on record	1

5 institutions · 25 of 49 vouchered records shown · 24 without an institution code

09Environmental DNA29 detections

Where the DNA of Diplolepis bassetti was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.70 °C 3.40–11.2

Seasonal swing summer↔winter23.2 °C

Max temp (day)14.4 °C 8.60–17.5

Min temp (night)3.20 °C -1.10–6.20

Precipitation38.3 mm/mo 18.4–89.3

Air humidity55.2 % 53.3–57.2

Moisture balance7.20 mm/mo -39.9–8.10

Vapour deficit493 Pa 335–602

Wind speed2.60 m/s 2.10–4.40

Cloud cover41.9 % 36.5–42.0

CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)