Atropus mentalis

species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Carangidae/Atropus

At a glance

Occurrence records228

Data sources4

Biological traits5

DNA specimens48

eDNA detections4

Sources4 archives

Databases and archives Atropus mentalis's data was compiled from.

GBIFGlobal Biodiversity Information Facility61 records↗

OBISOcean Biodiversity Information System167 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics48 specimens↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS228 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD48 specimens

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length100 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Uses & economy1

Commercial importancecommercial

Other traits1

Vulnerability60

05DNA & barcoding48 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atropus mentalis has left across the world's sequence archives.

At a glance

DNA specimens48

BINs2

Marker genes2

eDNA detections4

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus46 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 54 variable positions, in barcode order

55Gmostly conserved

94Amostly conserved

97Amostly conserved

163Amostly conserved

181Cmostly conserved

190Tmostly conserved

193Amostly conserved

194Cmostly conserved

205Amostly conserved

211Tmostly conserved

214Amostly conserved

220Tmostly conserved

223Cmostly conserved

247Tmostly conserved

256Tmostly conserved

259Amostly conserved

268Amostly conserved

283Amostly conserved

287Tmostly conserved

295Tmostly conserved

298Gmostly conserved

301Gmostly conserved

304Tmostly conserved

310Tmostly conserved

313Gmostly conserved

328Amostly conserved

334Tmostly conserved

340Amostly conserved

343Amostly conserved

346Gmostly conserved

388Amostly conserved

394Tmostly conserved

421Gmostly conserved

439Cmostly conserved

448Cmostly conserved

451Cmostly conserved

457Cmostly conserved

463Gmostly conserved

466Gmostly conserved

469Tmostly conserved

484Amostly conserved

493Cmostly conserved

505Tmostly conserved

508Amostly conserved

523Amostly conserved

526Tmostly conserved

539Tmostly conserved

547Gmostly conserved

554Cmostly conserved

562Tmostly conserved

565Amostly conserved

568Tmostly conserved

574Amostly conserved

598Cmostly conserved

CCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTAGGCACAGCTTTAAGCCTGCTTATTCGAGCAGAACTAAGCCAACCTGGCGCCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes8

BINs2

Most divergent pair0.61%

AsiaOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Atropus atropossame genus2.5%Atropus aurochssame genus2.8%Atropus hedlandensissame genus7.6%Atropus armatussame genus8.9%Craterognathus plagiotaeniasame family10.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P12S

animal barcodemarker

08Occurrence & distribution

Record type228 records

Wild obs. + sensor80

Museum / vouchered148

Range

Area of Occupancy AOO532 km²

Depth

0–200 m sunlit44

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 19 m · max 158.5 m · 44 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 20≤1 km 22≤10 km 4>10 km 3

49 georeferenced · 31 without coordinates

Open the mapobservation + sensor80

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 17≤1 km 13≤10 km 40>10 km 19

89 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence148

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	6

1 institutions · 6 of 148 vouchered records shown · 8 without an institution code

09Environmental DNA4 detections

Where the DNA of Atropus mentalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)