Atropus aurochs

species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Carangidae/Atropus

At a glance

Occurrence records1 125

Data sources3

Biological traits5

DNA specimens5

eDNA detections0

Sources3 archives

Databases and archives Atropus aurochs's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 records↗

OBISOcean Biodiversity Information System1 124 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS1 125 records

DNA & barcodingBOLD5 specimens

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length50 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic-neritic

Uses & economy1

Commercial importanceminor commercial

Other traits1

Vulnerability40

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atropus aurochs has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Diversity (π)3.2%

Haplotypes2

BINs2

Most divergent pair0.30%

Where individuals differ — all 52 variable positions, in barcode order

36Amostly conserved

102Amostly conserved

189Cmostly conserved

195Tmostly conserved

204Cmostly conserved

210Amostly conserved

216Tmostly conserved

219Gmostly conserved

222Tmostly conserved

249Cmostly conserved

252Tmostly conserved

258Cmostly conserved

267Tmostly conserved

273Gmostly conserved

291Tmostly conserved

294Amostly conserved

303Gmostly conserved

315Tmostly conserved

318Gmostly conserved

327Tmostly conserved

342Cmostly conserved

345Gmostly conserved

351Gmostly conserved

354Tmostly conserved

363Tmostly conserved

372Cmostly conserved

387Tmostly conserved

396Cmostly conserved

399Tmostly conserved

426Gmostly conserved

447Tmostly conserved

456Cmostly conserved

462Cmostly conserved

465Cmostly conserved

471Gmostly conserved

474Tmostly conserved

480Cmostly conserved

492Cvariable

498Tmostly conserved

502Cmostly conserved

504Gmostly conserved

510Tmostly conserved

522Gmostly conserved

559Cmostly conserved

564Amostly conserved

573Tmostly conserved

582Tmostly conserved

606Tmostly conserved

633Amostly conserved

636Cmostly conserved

639Cmostly conserved

642Tmostly conserved

GGCACCCTCTATCTAGTATTTGGTGCTTGAGCCGGAATAGTGGGCACAGCTTTAAGCCTGCTTATTCGAGCAGAACTAAGTCAACCTGGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Atropus mentalissame genus2.8%Atropus atropossame genus4.6%Atropus hedlandensissame genus7.9%Atropus armatussame genus9.2%Alectis ciliarissame family10.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 125 records

Wild obs. + sensor935

Museum / vouchered190

Range

Area of Occupancy AOO2 028 km²

Depth

0–200 m sunlit700

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 25.6 m · max 133 m · 700 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 929

932 georeferenced · 3 without coordinates

Open the mapobservation + sensor935

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 14≤1 km 29≤10 km 99>10 km 3

145 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence190

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Atropus aurochs

At a glance

Sources3 archives

Size & morphology1

Habitat & environment2

Uses & economy1

Other traits1

At a glance

Record type1 125 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Record type1 125 records