Atropus armatus

species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Carangidae/Atropus

At a glance

Occurrence records451

Data sources4

Biological traits9

DNA specimens60

eDNA detections53

Sources4 archives

Databases and archives Atropus armatus's data was compiled from.

GBIFGlobal Biodiversity Information Facility44 records↗

OBISOcean Biodiversity Information System407 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI53 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics60 specimens↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources9 traits

Occurrence & distributionGBIF · OBIS451 records

Environmental DNA1 datasets · 6 countries53 detections

DNA & barcodingBOLD60 specimens

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length58 cm

Body mass3 500 g

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonereef-associated

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max59 m

Depth min1 m

Vulnerability43.2

05DNA & barcoding60 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atropus armatus has left across the world's sequence archives.

At a glance

DNA specimens60

BINs3

Marker genes13

eDNA detections53

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P621 bp consensus47 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 60 variable positions, in barcode order

6Gmostly conserved

24Cvariable

45Cmostly conserved

63Gmostly conserved

66Gmostly conserved

132Gmostly conserved

150Tmostly conserved

159Cmostly conserved

163Tmostly conserved

174Gmostly conserved

180Cmostly conserved

183Gmostly conserved

189Cmostly conserved

192Tmostly conserved

216Cmostly conserved

225Cmostly conserved

237Gmostly conserved

249Gmostly conserved

252Gmostly conserved

256Cmostly conserved

258Amostly conserved

264Cmostly conserved

267Tmostly conserved

270Amostly conserved

273Cmostly conserved

279Cmostly conserved

282Amostly conserved

303Amostly conserved

309Gmostly conserved

312Cmostly conserved

315Amostly conserved

357Cmostly conserved

363Cmostly conserved

390Amostly conserved

405Tvariable

408Tmostly conserved

417Tmostly conserved

420Tmostly conserved

426Tmostly conserved

432Amostly conserved

435Amostly conserved

438Cmostly conserved

441Tvariable

453Gmostly conserved

462Tmostly conserved

474Cmostly conserved

492Cmostly conserved

495Cmostly conserved

508Cmostly conserved

516Tmostly conserved

523Tmostly conserved

531Cmostly conserved

534Gmostly conserved

537Cmostly conserved

543Gmostly conserved

567Tmostly conserved

585Tmostly conserved

603Tmostly conserved

606Cmostly conserved

615Amostly conserved

ATAGTGGGCACAGCTTTAAGCCTCCTTATTCGAGCAGAACTAAGCCAACCTGGCGCCCTTTTGGGGGACGACCAAATTTATAATGTTATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.3%

Haplotypes9

BINs3

Most divergent pair10.6%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Atropus mentalissame genus8.9%Atropus aurochssame genus9.2%Atropus hedlandensissame genus9.9%Atropus atropossame genus9.9%Craterognathus plagiotaeniasame family11.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16SCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND612S

animal barcoderibosomalmitochondrialmarker

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_004405 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBs-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type451 records

Wild obs. + sensor212

Museum / vouchered238

Other1

Range

Area of Occupancy AOO1 284 km²

Depth

0–200 m sunlit176

200–1000 m twilight1

1–4 km midnight0

>4 km abyssal0

median 46.2 m · max 317.5 m · 177 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 14≤1 km 141≤10 km 1>10 km 2

158 georeferenced · 54 without coordinates

Open the mapobservation + sensor212

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 34≤1 km 4≤10 km 62>10 km 36

136 georeferenced · 102 without coordinates

Open the institutions mapphysical evidence238

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	3
Sher-e-Bangla Agricultural University, Department of Fisheries Biology and Genetics, Aquatic Bioresource Research Lablocation not on record	1

2 institutions · 4 of 238 vouchered records shown · 3 without an institution code

09Environmental DNA53 detections

Where the DNA of Atropus armatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found53

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 53 detections have coordinates

Open the map6 countries0

MangroveMarine

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.4 °C 23.8–27.6

Seasonal swing summer↔winter6.50 °C

Max temp (day)29.2 °C 24.9–30.7

Min temp (night)23.2 °C 18.4–25.7

Precipitation133 mm/mo 9.50–232

Air humidity63.3 % 38.1–68.5

Moisture balance-0.1 mm/mo

Vapour deficit1,273 Pa 1,055–2,223

Wind speed2.80 m/s

Cloud cover43.0 % 10.4–61.4

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)