Atropus hedlandensis

species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Carangidae/Atropus

At a glance

Occurrence records1 615

Data sources4

Biological traits6

DNA specimens116

eDNA detections99

Sources4 archives

Databases and archives Atropus hedlandensis's data was compiled from.

GBIFGlobal Biodiversity Information Facility54 records↗

OBISOcean Biodiversity Information System1 561 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI99 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics116 specimens↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS1 615 records

Environmental DNA1 datasets · 10 countries99 detections

DNA & barcodingBOLD116 specimens

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length32 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonereef-associated

Uses & economy1

Commercial importancecommercial

Other traits2

Depth max40 m

Vulnerability22

05DNA & barcoding116 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Atropus hedlandensis has left across the world's sequence archives.

At a glance

DNA specimens116

BINs3

Marker genes2

eDNA detections99

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P648 bp consensus100 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

3Cmostly conserved

7Cmostly conserved

10Gmostly conserved

30Tmostly conserved

36Gmostly conserved

183Tmostly conserved

198Tvariable

267Amostly conserved

279Amostly conserved

309Amostly conserved

312Gvariable

339Amostly conserved

348Gmostly conserved

450Amostly conserved

468Amostly conserved

627Gmostly conserved

630Tmostly conserved

CTCTATCTAGTATTTGGTGCTTGAGCCGGTATAGTGGGCACAGCTTTAAGCCTGCTTATTCGAGCAGAACTAAGTCAACCTGGCGCCCTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes24

BINs3

Most divergent pair12.8%

AsiaOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Atropus mentalissame genus7.6%Atropus aurochssame genus7.9%Atropus atropossame genus8.2%Atropus armatussame genus9.9%Craterognathus plagiotaeniasame family11.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P12S

animal barcodemarker

08Occurrence & distribution

Record type1 615 records

Wild obs. + sensor1 186

Museum / vouchered424

Cultivated / captive5

Range

Area of Occupancy AOO2 620 km²

Depth

0–200 m sunlit922

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 18 m · max 152.5 m · 922 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 91≤1 km 1 041≤10 km 4>10 km 8

1 144 georeferenced · 42 without coordinates

Open the mapobservation + sensor1 186

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 24≤1 km 47≤10 km 128>10 km 30

229 georeferenced · 195 without coordinates

Open the institutions mapphysical evidence424

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 5

5 georeferenced

Open the mapnot free-living5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Fisheries Research Laboratory, Mie Universitylocation not on record	1
Universiti Malaysia Terengganulocation not on record	1
Institut Halieutique et des Sciences Marineslocation not on record	1
National Marine Biodiversity Institute of Korealocation not on record	1

4 institutions · 4 of 424 vouchered records shown · 16 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA99 detections

Where the DNA of Atropus hedlandensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found99

Studies independent surveys1

Countries10

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 99 detections have coordinates

Open the map10 countries0

MangrovePelagic region

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.6 °C 22.2–27.9

Seasonal swing summer↔winter1.90 °C

Max temp (day)28.5 °C 24.8–29.8

Min temp (night)24.4 °C 19.6–26.0

Precipitation138 mm/mo 13.8–280

Air humidity64.8 % 55.3–68.5

Moisture balance48.5 mm/mo

Vapour deficit1,188 Pa 1,073–1,353

Wind speed2.90 m/s

Cloud cover47.1 % 24.1–70.3

CHELSA 1981–2010, ~9 km grid, at location & month of 51 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Atropus hedlandensis

At a glance

Sources4 archives

Size & morphology1

Habitat & environment2

Uses & economy1

Other traits2

At a glance

Record type1 615 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 615 records