Arigomphus villosipes

(Selys, 1854) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Odonata/Gomphidae/Arigomphus

At a glance

Occurrence records4 634

Data sources8

Biological traits0

DNA specimens7

eDNA detections0

Sources8 archives

Databases and archives Arigomphus villosipes's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 634 records↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.80 Gbp↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF4 634 records

DNA & barcodingBOLD7 specimens

Genome at a glanceGoaT802 Mbp

01Narrative

Arigomphus villosipes, the unicorn clubtail, is a species of clubtail in the dragonfly family Gomphidae. It is found in North America. The IUCN conservation status of Arigomphus villosipes is "LC", least concern, with no immediate threat to the species' survival. The population is stable. The IUCN status was reviewed in 2017. Unicorn clubtail, Arigomphus villosipes Unicorn clubtail, Arigomphus villosipes

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arigomphus villosipes has left across the world's sequence archives.

At a glance

DNA specimens7

BINs2

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 86% of positions are identical in every specimen.

Diversity (π)4.0%

Haplotypes2

BINs2

Most divergent pair0.46%

Where individuals differ — all 91 variable positions, in barcode order

22Tmostly conserved

23Gmostly conserved

24Cmostly conserved

25Tmostly conserved

27Gmostly conserved

28Amostly conserved

29Gmostly conserved

30Cmostly conserved

31Amostly conserved

40Gmostly conserved

55Amostly conserved

59Cmostly conserved

79Tmostly conserved

91Tmostly conserved

92Cmostly conserved

94Gmostly conserved

106Cmostly conserved

118Tmostly conserved

122Gmostly conserved

130Amostly conserved

142Tmostly conserved

157Tmostly conserved

181Amostly conserved

184Amostly conserved

197Tmostly conserved

202Amostly conserved

212Tmostly conserved

220Tmostly conserved

229Amostly conserved

232Amostly conserved

238Cmostly conserved

241Tmostly conserved

250Cmostly conserved

265Amostly conserved

266Cmostly conserved

268Tmostly conserved

274Tmostly conserved

277Amostly conserved

282Cmostly conserved

283Cmostly conserved

292Amostly conserved

295Tmostly conserved

301Amostly conserved

302Tmostly conserved

307Gmostly conserved

328Gmostly conserved

358Tmostly conserved

361Cmostly conserved

364Tmostly conserved

373Gvariable

379Amostly conserved

386Cmostly conserved

400Cmostly conserved

401Tmostly conserved

403Gmostly conserved

406Cmostly conserved

409Cmostly conserved

412Tmostly conserved

428Tmostly conserved

442Tmostly conserved

457Cmostly conserved

460Cmostly conserved

463Tmostly conserved

481Amostly conserved

484Gmostly conserved

485Tmostly conserved

490Tmostly conserved

500Cmostly conserved

502Tmostly conserved

505Cmostly conserved

514Amostly conserved

517Tmostly conserved

520Amostly conserved

526Tmostly conserved

539Tmostly conserved

542Cmostly conserved

547Amostly conserved

557Cmostly conserved

559Tmostly conserved

568Tmostly conserved

577Amostly conserved

578Tmostly conserved

583Gmostly conserved

586Tmostly conserved

595Cmostly conserved

616Tmostly conserved

622Tmostly conserved

628Gmostly conserved

637Tmostly conserved

653Tmostly conserved

658Tmostly conserved

AACTCTATATTTACTATTTGGTGCTTGAGCAGGGATAGTGGGAACTGCTTTAAGAATACTAATTCGAATTGAATTAGGTCAACCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arigomphus submedianussame genus4.4%Arigomphus furcifersame genus6.4%Arigomphus cornutussame genus6.4%Hylogomphus adelphussame family12.3%Phanogomphus descriptussame family12.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Arigomphus villosipes carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size801 960 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Arigomphus villosipes0.80 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type4 634 records

Wild obs. + sensor3 991

Museum / vouchered643

Range

Area of Occupancy AOO7 840 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 1 373≤1 km 770≤10 km 168>10 km 267

2 578 georeferenced · 1 413 without coordinates

Open the mapobservation + sensor3 991

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 51≤1 km 29≤10 km 141>10 km 9

230 georeferenced · 413 without coordinates

Open the institutions mapphysical evidence643

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Odonata Centrallocation not on record	165
Cornell University Insect Collectionlocation not on record	128
Washington, US	119
Toronto, CA	38
OSUClocation not on record	27
Champaign, US	19
Cleveland Museum of Natural History, OH (CLEV)location not on record	16
East Lansing, US	13
University Park, US	11
New Haven, US	10
Saint John, CA	4
CASlocation not on record	1
Blacksburg, US	1
Bonn, DE	1

14 institutions · 553 of 643 vouchered records shown · 90 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arigomphus villosipes

At a glance

Sources8 archives

At a glance

Genome sizehow big the whole instruction manual is

Record type4 634 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 14 geolocated

Record type4 634 records