Arigomphus cornutus

(Tough, 1900) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Odonata/Gomphidae/Arigomphus

At a glance

Occurrence records1 102

Data sources8

Biological traits0

DNA specimens7

eDNA detections4

Sources8 archives

Databases and archives Arigomphus cornutus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 102 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 102 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD7 specimens

01Narrative

The horned clubtail (Arigomphus cornutus) is a clubtail dragonfly of Canada and the United States. The horned clubtail is 2.2 in long and lacks an abdominal club. It has a greenish thorax with black stripes and a black abdomen with a light stripe along the top. It has blue eyes and black legs. It also has distinctive wide forked yellow claspers shaped like cow horns and a large sloped bridge between the eyes. Ottawa, Ontario The horned clubtail lives in ponds and sluggish streams. Its range includes Canada and several U.S. states: Colorado Iowa Minnesota Montana – Carter, Custer, Fallon, Powder River, and Wibaux Counties; only in artificial reservoirs. Nebraska – Cherry and Cuming Counties New York – (rarely) North Dakota South Dakota Wisconsin Wyoming

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arigomphus cornutus has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes3

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P640 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)2.0%

Haplotypes2

BIN1

Most divergent pair0.47%

Where individuals differ — all 27 variable positions, in barcode order

25Gmostly conserved

28Amostly conserved

44Cmostly conserved

79Amostly conserved

196Avariable

199Gmostly conserved

232Tmostly conserved

235Tvariable

247Gmostly conserved

253Cmostly conserved

263Tmostly conserved

331Tvariable

334Tmostly conserved

346Cvariable

373Amostly conserved

391Cmostly conserved

400Amostly conserved

418Gvariable

457Amostly conserved

469Gmostly conserved

470Cvariable

523Tmostly conserved

532Tmostly conserved

559Gmostly conserved

574Cmostly conserved

583Tmostly conserved

586Tmostly conserved

ATTTGGTGCTTGAGCAGGAATAGTGGGAACTGCTTTAAGAATACTAATTCGAATTGAATTAGGTCAACCAGGATCTCTAATTGGAGACGA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arigomphus villosipessame genus6.4%Arigomphus submedianussame genus8.2%Hylogomphus adelphussame family11.6%Phanogomphus kurilissame family11.7%Phanogomphus exilissame family12.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5PCYTB

animal barcoderibosomalmitochondrial

08Occurrence & distribution

Record type1 102 records

Wild obs. + sensor885

Museum / vouchered217

Range

Area of Occupancy AOO2 808 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 267≤1 km 103≤10 km 19>10 km 124

513 georeferenced · 372 without coordinates

Open the mapobservation + sensor885

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 7≤1 km 11≤10 km 10

28 georeferenced · 189 without coordinates

Open the institutions mapphysical evidence217

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Odonata Centrallocation not on record	108
Toronto, CA	11
East Lansing, US	11
Cornell University Insect Collectionlocation not on record	8
WIlocation not on record	3
Washington, US	3
Albuquerque, US	2
University of Michigan, Museum of Zoologylocation not on record	2
Saint John, CA	2
Essig Museum of Entomologylocation not on record	2
Université Lavallocation not on record	2
Colorado State Universitylocation not on record	1
Chicago, US	1
Central Michigan University, Biology Departmentlocation not on record	1

14 institutions · 157 of 217 vouchered records shown · 60 without an institution code

09Environmental DNA4 detections

Where the DNA of Arigomphus cornutus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

pondSparganium

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 7.40–19.2

Seasonal swing summer↔winter28.8 °C

Max temp (day)20.1 °C 10.4–23.7

Min temp (night)13.2 °C 5.20–16.1

Precipitation73.5 mm/mo 73.2–88.9

Air humidity59.3 % 59.1–60.7

Moisture balance-52.9 mm/mo -87.9–-5.80

Vapour deficit753 Pa 499–918

Wind speed2.70 m/s 2.60–3.90

Cloud cover41.6 % 38.6–48.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arigomphus cornutus

At a glance

Sources8 archives

At a glance

Record type1 102 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 102 records