Arigomphus submedianus

(Williamson, 1914) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Odonata/Gomphidae/Arigomphus

At a glance

Occurrence records2 796

Data sources10

Biological traits0

DNA specimens5

eDNA detections1

Sources10 archives

Databases and archives Arigomphus submedianus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 796 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 796 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD5 specimens

Genome at a glanceGoaT · TreeOfSex2n = 24

01Narrative

The jade clubtail (Arigomphus submedianus) is a dragonfly in the Gomphidae family. Its total length is 51 to 55mm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arigomphus submedianus has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P500 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Diversity (π)2.8%

Haplotypes1

BINs2

Where individuals differ — all 21 variable positions, in barcode order

113Tmostly conserved

134Tmostly conserved

179Gmostly conserved

200Amostly conserved

220Cmostly conserved

221Cmostly conserved

236Cmostly conserved

249Tmostly conserved

254Tmostly conserved

291Cmostly conserved

293Gmostly conserved

326Cmostly conserved

377Amostly conserved

410Avariable

411Cvariable

452Cvariable

458Cvariable

470Avariable

479Cvariable

482Gvariable

500Cvariable

CATTTGTAATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGGTTTGGAAATTGATTAGTACCTCTTATATTAGGAGCTCCTGATA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arigomphus villosipessame genus4.4%Arigomphus cornutussame genus8.2%Arigomphus furcifersame genus8.4%Dromogomphus spinosussame family11.8%Phanogomphus exilissame family12.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Arigomphus submedianus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Chromosome records24–242n range24median24mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 245×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Cruden RW (1968) Chromosome numbers of some North American dragonflies (Odonata). Canadian Journal of Genetics and Cytology 10: 200-214. ↗

TreeOfSex · invert — Kiauta B (1969) Sex chromosomes and sex determining mechanisms in Odonata, with a review of the cytological conditions in the family Gomphidae, and references to the karyotypic evolution in the order. Genetica 40: 127-157. ↗

2n 233×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

08Occurrence & distribution

Record type2 796 records

Wild obs. + sensor2 651

Museum / vouchered145

Range

Area of Occupancy AOO4 400 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 1 014≤1 km 291≤10 km 78>10 km 143

1 526 georeferenced · 1 125 without coordinates

Open the mapobservation + sensor2 651

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 13≤1 km 27≤10 km 18>10 km 2

60 georeferenced · 85 without coordinates

Open the institutions mapphysical evidence145

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Odonata Centrallocation not on record	73
Champaign, US	25
Wuzhou, CN	21
Cornell University Insect Collectionlocation not on record	9
Washington, US	4
University Park, US	3
University of Michigan, Museum of Zoologylocation not on record	1
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1

8 institutions · 137 of 145 vouchered records shown · 8 without an institution code

09Environmental DNA1 detections

Where the DNA of Arigomphus submedianus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arigomphus submedianus

At a glance

Sources10 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 796 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 8 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type2 796 records