Arigomphus furcifer

(Hagen, 1878) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Odonata/Gomphidae/Arigomphus

At a glance

Occurrence records1 487

Data sources7

Biological traits0

DNA specimens11

eDNA detections0

Sources7 archives

Databases and archives Arigomphus furcifer's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 487 records↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 487 records

DNA & barcodingBOLD11 specimens

01Narrative

Arigomphus furcifer, the lilypad clubtail, is a species of clubtail in the family of dragonflies known as Gomphidae. It is found in North America. The IUCN conservation status of Arigomphus furcifer is "LC", least concern, with no immediate threat to the species' survival. The population is stable.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arigomphus furcifer has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

433Gmostly conserved

622Cmostly conserved

634Cmostly conserved

AACTCTATATTTACTATTTGGTGCTTGAGCAGGAATAGTGGGAACTGCTTTAAGAATACTAATTCGAATTGAATTAGGTCAACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.15%

Haplotypes4

BIN1

Most divergent pair0.46%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arigomphus villosipessame genus6.4%Arigomphus submedianussame genus8.4%Hylogomphus adelphussame family11.9%Phanogomphus kurilissame family12.3%Phanogomphus exilissame family12.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 487 records

Wild obs. + sensor1 137

Museum / vouchered350

Range

Area of Occupancy AOO3 236 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 310≤1 km 105≤10 km 28>10 km 276

719 georeferenced · 418 without coordinates

Open the mapobservation + sensor1 137

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 25≤1 km 62≤10 km 21>10 km 2

110 georeferenced · 240 without coordinates

Open the institutions mapphysical evidence350

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Odonata Centrallocation not on record	129
Toronto, CA	75
Cornell University Insect Collectionlocation not on record	20
Washington, US	14
Université Lavallocation not on record	11
OSUClocation not on record	10
Saint John, CA	9
University of Guelph, Centre for Biodiversity Genomicslocation not on record	7
East Lansing, US	6
Cleveland Museum of Natural History, OH (CLEV)location not on record	5
New Haven, US	2
Champaign, US	2
Vancouver, CA	1
University Park, US	1

14 institutions · 292 of 350 vouchered records shown · 58 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arigomphus furcifer

At a glance

Sources7 archives

At a glance

Record type1 487 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 14 geolocated

Record type1 487 records