Argyresthia praecocella

Zeller, 1839 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Argyresthiidae/Argyresthia

At a glance

Occurrence records340

Data sources7

Biological traits2

DNA specimens10

eDNA detections36

Sources7 archives

Databases and archives Argyresthia praecocella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility340 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI36 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF340 records

Environmental DNA3 datasets · 6 countries36 detections

DNA & barcodingBOLD10 specimens

01Narrative

Argyresthia praecocella, the ochreous argent or juniper berry miner moth, is a moth of the family Yponomeutidae. It is found in most of Europe, except Ireland, Portugal and the Balkan Peninsula.Fauna Europaea It is also found in Russia and across the Palearctic to Japan. The wingspan is 9–10 mm.microlepidoptera.nl The larvae feed on Juniperus communis and Juniperus rigida.Argyresthia at funet They feed within the berries of their host plant. The species overwinters as a prepupa.Hants Moths

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyresthia praecocella has left across the world's sequence archives.

At a glance

DNA specimens10

BINs2

Marker genes1

eDNA detections36

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 61 variable positions, in barcode order

2Amostly conserved

22Amostly conserved

23Amostly conserved

25Cmostly conserved

35Amostly conserved

43Tmostly conserved

46Tmostly conserved

49Cmostly conserved

82Tmostly conserved

85Amostly conserved

100Amostly conserved

103Cvariable

169Amostly conserved

202Amostly conserved

205Tmostly conserved

220Tmostly conserved

263Cvariable

266Tmostly conserved

268Amostly conserved

277Cmostly conserved

287Cmostly conserved

292Tmostly conserved

302Gmostly conserved

304Amostly conserved

313Tmostly conserved

364Amostly conserved

367Cmostly conserved

368Amostly conserved

370Amostly conserved

376Amostly conserved

379Amostly conserved

382Tmostly conserved

400Amostly conserved

403Gvariable

412Avariable

421Cmostly conserved

424Tmostly conserved

436Tmostly conserved

442Tmostly conserved

457Cvariable

463Cmostly conserved

466Avariable

472Cmostly conserved

486Amostly conserved

488Gmostly conserved

492Amostly conserved

493Amostly conserved

512Gmostly conserved

517Amostly conserved

518Avariable

520Tmostly conserved

526Amostly conserved

547Tmostly conserved

548Cmostly conserved

550Cmostly conserved

554Gvariable

565Tmostly conserved

568Tmostly conserved

607Amostly conserved

637Tmostly conserved

646Tmostly conserved

AACATTATATTTTATTTTTGGAATCTGATCTGGAATAGTAGGTACTTCCTTAAGATTATTAATTCGAGCAGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.5%

Haplotypes6

BINs2

Most divergent pair8.5%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyresthia sabinaesame genus7.3%Argyresthia reticulatasame genus7.9%Argyresthia quadristrigellasame genus8.1%Argyresthia aurulentellasame genus8.1%Argyresthia arceuthinasame genus8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type340 records

Wild obs. + sensor248

Museum / vouchered92

Range

Area of Occupancy AOO836 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 98≤1 km 67≤10 km 60>10 km 3

228 georeferenced · 20 without coordinates

Open the mapobservation + sensor248

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy93% within 1 km

≤100 m 44≤1 km 26≤10 km 5

75 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence92

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	26
Tartu, EE	9
SLU Artdatabankenlocation not on record	8
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	8
DanishLepidopterologicalSocietylocation not on record	7
Stockholm, SE	5
South Kensington, GB	2
Salzburg, AT	1
Kuopio, FI	1
Tilburg, NL	1
neflocation not on record	1
University of Oulu, Zoological Museumlocation not on record	1

12 institutions · 70 of 92 vouchered records shown · 22 without an institution code

09Environmental DNA36 detections

Where the DNA of Argyresthia praecocella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found36

Studies independent surveys3

Countries6

Verifiable raw sequence linked22

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 36 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.40 °C 6.00–13.2

Seasonal swing summer↔winter17.2 °C

Max temp (day)9.70 °C 9.50–16.9

Min temp (night)7.20 °C 1.20–9.60

Precipitation40.0 mm/mo 38.0–80.8

Air humidity60.3 % 56.8–60.4

Moisture balance-55.5 mm/mo -67.4–-11.7

Vapour deficit438 Pa 390–597

Wind speed4.50 m/s 2.30–5.30

Cloud cover39.6 % 38.9–47.5

CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)