Argyresthia dilectella

Zeller, 1874 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Argyresthiidae/Argyresthia

At a glance

Occurrence records1 162

Data sources7

Biological traits2

DNA specimens14

eDNA detections29

Sources7 archives

Databases and archives Argyresthia dilectella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 162 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 162 records

Environmental DNA3 datasets · 7 countries29 detections

DNA & barcodingBOLD14 specimens

01Narrative

Argyresthia dilectella is a moth of the family Yponomeutidae. It is found in Northern Europe and Central Europe.Fauna Europaea The wingspan is 7–9 mm. The head is white. Forewings are violet-whitish, suffusedly mixed and irrorated with brownish golden; a transverse oblique mark from middle of dorsum, a small spot on middle of costa and another beyond it usually darker golden-brown ; some small darker spots towards apex. Hindwings are pale grey.Meyrick, E., 1895 A Handbook of British Lepidoptera MacMillan, London pdf Keys and description The moth flies from June to August. . The larvae feed on Juniperus communis and Chamaecyparis.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)does not feed

Feeding guild (larval)herbivore

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyresthia dilectella has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections29

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

133Tmostly conserved

220Amostly conserved

265Gmostly conserved

346Tmostly conserved

500Cmostly conserved

505Tmostly conserved

625Gvariable

AACATTATATTTTATTTTCGGAATTTGATCTGGAATAATAGGAACATCTTTAAGATTATTAATTCGAGCTGAACTAGGTAACCCCGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.24%

Haplotypes5

BIN1

Most divergent pair0.46%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyresthia aurulentellasame genus7.6%Argyresthia arceuthinasame genus7.9%Argyresthia trifasciatasame genus8.1%Argyresthia columbiasame genus8.2%Argyresthia amiantellasame genus8.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 162 records

Wild obs. + sensor974

Museum / vouchered188

Range

Area of Occupancy AOO2 280 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 409≤1 km 188≤10 km 314>10 km 2

913 georeferenced · 61 without coordinates

Open the mapobservation + sensor974

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 91≤1 km 33≤10 km 13>10 km 17

154 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence188

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	42
DanishLepidopterologicalSocietylocation not on record	31
Oulu, FI	28
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	20
Tartu, EE	12
SLU Artdatabankenlocation not on record	12
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	4
Natural History Museum Rotterdamlocation not on record	4
NTNU-VMlocation not on record	2
ZSMlocation not on record	1
Rovaniemi, FI	1
Kuopio, FI	1

12 institutions · 158 of 188 vouchered records shown · 30 without an institution code

09Environmental DNA29 detections

Where the DNA of Argyresthia dilectella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found29

Studies independent surveys3

Countries7

Verifiable raw sequence linked12

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 29 detections have coordinates

Open the map7 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 7.40–16.8

Seasonal swing summer↔winter18.9 °C

Max temp (day)18.2 °C 11.4–21.2

Min temp (night)10.0 °C 3.80–13.4

Precipitation88.9 mm/mo 57.3–194

Air humidity60.5 % 58.1–64.4

Moisture balance-25.0 mm/mo -55.5–104

Vapour deficit674 Pa 396–786

Wind speed2.70 m/s 2.20–3.80

Cloud cover41.7 % 36.0–54.8

CHELSA 1981–2010, ~9 km grid, at location & month of 25 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argyresthia dilectella

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type1 162 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 162 records