Argyresthia aureoargentella

Brower, 1953 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Argyresthiidae/Argyresthia

At a glance

Occurrence records139

Data sources7

Biological traits0

DNA specimens15

eDNA detections13

Sources7 archives

Databases and archives Argyresthia aureoargentella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility139 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF139 records

Environmental DNA1 datasets · 1 countries13 detections

DNA & barcodingBOLD15 specimens

01Narrative

Argyresthia aureoargentella is a moth of the family Yponomeutidae. It is found in North America, including Ontario and Quebec.mothphotographersgroup Adults are whitish. They are on wing from early June to late July. There is one generation per year.Common Pests of Trees in Ontario The larvae feed on Thuja occidentalis. They mine the leaves of their host plant. Pupation takes place in a whitish, spindle-shaped cocoon that is located outside the mine on the foliage.Caterpillars On The Foliage Of Conifers In The Northeastern United States

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argyresthia aureoargentella has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections13

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

43Amostly conserved

278Tmostly conserved

343Cmostly conserved

403Gmostly conserved

445Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGATCTGGTATAGTAGGAACATCATTAAGATTATTAATTCGAGCTGAATTAGGTAACCCAGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.18%

Haplotypes4

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argyresthia columbiasame genus7.9%Argyresthia arceuthinasame genus7.9%Argyresthia cupressellasame genus8.2%Argyresthia amiantellasame genus8.4%Argyresthia pseudotsugasame genus8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type139 records

Wild obs. + sensor126

Museum / vouchered13

Range

Area of Occupancy AOO260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 97≤1 km 8≤10 km 1>10 km 7

113 georeferenced · 13 without coordinates

Open the mapobservation + sensor126

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 13 records without

Open the institutions mapphysical evidence13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	9
Research Collection of Daniel Handfieldlocation not on record	2

2 institutions · 11 of 13 vouchered records shown · 2 without an institution code

09Environmental DNA13 detections

Where the DNA of Argyresthia aureoargentella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map1 country0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 18.1–20.9

Seasonal swing summer↔winter31.1 °C

Max temp (day)23.4 °C 22.8–25.8

Min temp (night)14.2 °C 13.2–16.5

Precipitation88.2 mm/mo 76.0–117

Air humidity59.0 % 58.3–60.5

Moisture balance-49.9 mm/mo -81.3–-17.0

Vapour deficit876 Pa 835–992

Wind speed2.70 m/s 2.20–5.10

Cloud cover43.5 % 39.6–49.7

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)