Argia bipunctulata

(Hagen, 1861) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Odonata/Coenagrionidae/Argia

At a glance

Occurrence records3 095

Data sources9

Biological traits0

DNA specimens8

eDNA detections8

Sources9 archives

Databases and archives Argia bipunctulata's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 095 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.92 Gbp↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 095 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD8 specimens

Genome at a glanceGoaT919 Mbp

01Narrative

Argia bipunctulata, the seepage dancer, is a species of narrow-winged damselfly in the family Coenagrionidae. It is found in North America. The IUCN conservation status of Argia bipunctulata is "LC", least concern, with no immediate threat to the species' survival. The population is stable. Seepage dancer, Argia bipunctulata Seepage dancer, Argia bipunctulata

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argia bipunctulata has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.25%

Haplotypes1

BIN1

Where individuals differ — all 3 variable positions, in barcode order

388Gvariable

484Avariable

536Cvariable

AACTCTTTATTTAATGTTCGGAGCATGGGCAGGAATAGTAGGAACCGCATTAAGAATACTAATCCGAGTAGAGCTGGGACAACCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argia fumipennissame genus11.9%Argia hineisame genus12.2%Argia sedulasame genus13.7%Argia tibialissame genus14.4%Argia emmasame genus14.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Argia bipunctulata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size919 320 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Argia bipunctulata0.92 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type3 095 records

Wild obs. + sensor2 424

Museum / vouchered671

Range

Area of Occupancy AOO2 828 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 580≤1 km 485≤10 km 38>10 km 480

1 583 georeferenced · 841 without coordinates

Open the mapobservation + sensor2 424

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy35% within 1 km

≤100 m 28≤1 km 24≤10 km 75>10 km 20

147 georeferenced · 524 without coordinates

Open the institutions mapphysical evidence671

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	182
Odonata Centrallocation not on record	64
Cornell University Insect Collectionlocation not on record	32
Toronto, CA	27
OSUClocation not on record	23
East Lansing, US	17
Wuzhou, CN	15
Montréal, CA	4
University Park, US	4
Chicago, US	2
University of Central Floridalocation not on record	2
The University of the West Indies, Trinidad and Tobagolocation not on record	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
Champaign, US	1

14 institutions · 375 of 671 vouchered records shown · 296 without an institution code

09Environmental DNA8 detections

Where the DNA of Argia bipunctulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.5 °C 23.5–24.4

Seasonal swing summer↔winter16.2 °C

Max temp (day)29.6 °C 29.6–29.8

Min temp (night)18.2 °C 18.2–19.9

Precipitation82.4 mm/mo 73.5–85.8

Air humidity57.4 % 56.8–58.2

Moisture balance-85.8 mm/mo -85.9–-76.3

Vapour deficit1,241 Pa 1,225–1,282

Wind speed2.10 m/s 2.00–2.40

Cloud cover37.0 % 33.3–38.9

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argia bipunctulata

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Record type3 095 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 14 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 095 records