Argia tibialis

(Rambur, 1842) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Odonata/Coenagrionidae/Argia

At a glance

Occurrence records14 372

Data sources9

Biological traits0

DNA specimens5

eDNA detections3

Sources9 archives

Databases and archives Argia tibialis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility14 372 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.86 Gbp↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF14 372 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD5 specimens

Genome at a glanceGoaT861 Mbp

01Narrative

Argia tibialis, the blue-tipped dancer, is a species of narrow-winged damselfly in the family Coenagrionidae. It is found in Central America and North America. The IUCN conservation status of Argia tibialis is "LC", least concern, with no immediate threat to the species' survival. The population is stable. Blue-tipped dancer, Argia tibialis Blue-tipped dancer, Argia tibialis

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argia tibialis has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.35%

Haplotypes2

BIN1

Most divergent pair0.46%

Where individuals differ — all 3 variable positions, in barcode order

40Avariable

367Tvariable

472Gvariable

AACTCTTTATCTAATATTCGGAGCATGGGCAGGAATAGTAGGGACTGCATTAAGTATATTAATTCGAGTAGAATTGGGACAACCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Africallagma quingentumsame family13.7%Africallagma elongatumsame family13.8%Argia hineisame genus13.9%Ischnura hastatasame family14.3%Argia sedulasame genus14.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Argia tibialis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size860 640 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Argia tibialis0.86 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type14 372 records

Wild obs. + sensor12 497

Museum / vouchered1 875

Range

Area of Occupancy AOO20 924 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 4 453≤1 km 2 397≤10 km 361>10 km 922

8 133 georeferenced · 4 364 without coordinates

Open the mapobservation + sensor12 497

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 30≤1 km 135≤10 km 151>10 km 31

347 georeferenced · 1 528 without coordinates

Open the institutions mapphysical evidence1 875

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	337
Odonata Centrallocation not on record	331
OSUClocation not on record	120
Wuzhou, CN	80
Champaign, US	70
Cornell University Insect Collectionlocation not on record	62
East Lansing, US	61
Cleveland Museum of Natural History, OH (CLEV)location not on record	34
St. Paul, US	30
Toronto, CA	19
University Park, US	11
Sam Noble Oklahoma Museum of Natural Historylocation not on record	9
Montréal, CA	5
University of Michigan, Museum of Zoologylocation not on record	2
University of Central Floridalocation not on record	2
Lubbock, US	1

16 institutions · 1 174 of 1 875 vouchered records shown · 701 without an institution code

09Environmental DNA3 detections

Where the DNA of Argia tibialis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.5 °C 23.5–23.5

Seasonal swing summer↔winter16.3 °C

Max temp (day)29.6 °C

Min temp (night)18.2 °C

Precipitation82.4 mm/mo

Air humidity57.4 %

Moisture balance-76.3 mm/mo

Vapour deficit1,225 Pa

Wind speed2.00 m/s

Cloud cover38.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argia tibialis

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Record type14 372 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type14 372 records