Argia emma

Kennedy, 1916 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Odonata/Coenagrionidae/Argia

At a glance

Occurrence records2 572

Data sources8

Biological traits0

DNA specimens10

eDNA detections1

Sources8 archives

Databases and archives Argia emma's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 572 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 572 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD10 specimens

01Narrative

Argia emma, or Emma's dancer, is a species of narrow-winged damselfly in the family Coenagrionidae. It is found in North America. The IUCN conservation status of Argia emma is "LC", least concern, with no immediate threat to the species' survival. The population is stable.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argia emma has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.30%

Haplotypes0

BIN1

Where individuals differ — all 4 variable positions, in barcode order

217Gmostly conserved

340Tmostly conserved

355Gmostly conserved

472Gmostly conserved

AACTCTTTATCTAATATTTGGAGCATGGGCAGGAATAGTAGGAACTGCTTTAAGAATATTAATTCGAGTAGAATTAGGACAGCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argia hineisame genus12.2%Argia cupraureasame genus12.9%Argia sedulasame genus13.1%Argia fumipennissame genus13.4%Argia moestasame genus14.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 572 records

Wild obs. + sensor1 879

Museum / vouchered691

Cultivated / captive2

Origin

Native6

Range

Area of Occupancy AOO3 980 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 900≤1 km 283≤10 km 71>10 km 44

1 298 georeferenced · 581 without coordinates

Open the mapobservation + sensor1 879

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 59≤1 km 57≤10 km 177>10 km 5

298 georeferenced · 393 without coordinates

Open the institutions mapphysical evidence691

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Odonata Centrallocation not on record	190
Washington, US	59
Vancouver, CA	40
Essig Museum of Entomologylocation not on record	34
Toronto, CA	30
San Francisco, US	26
UCBMElocation not on record	21
St. Paul, US	16
CASlocation not on record	11
Los Angeles, US	6
Chicago, US	6
East Lansing, US	5
Cornell University Insect Collectionlocation not on record	4
Royal British Columbia Museumlocation not on record	4
New Haven, US	2
Albuquerque, US	2
Champaign, US	2
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
Montréal, CA	1

19 institutions · 460 of 691 vouchered records shown · 231 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Argia emma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argia emma

At a glance

Sources8 archives

At a glance

Record type2 572 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions12 of 19 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type2 572 records