Argia moesta

(Hagen, 1861) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Odonata/Coenagrionidae/Argia

At a glance

Occurrence records31 378

Data sources9

Biological traits0

DNA specimens84

eDNA detections91

Sources9 archives

Databases and archives Argia moesta's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility31 378 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI91 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics84 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.88 Gbp↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF31 378 records

Environmental DNA1 datasets · 2 countries91 detections

DNA & barcodingBOLD84 specimens

Genome at a glanceGoaT880 Mbp

01Narrative

The powdered dancer (Argia moesta) is a damselfly of the family Coenagrionidae. It is native to North America. It may be seen year-round in at least some of its range.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding84 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argia moesta has left across the world's sequence archives.

At a glance

DNA specimens84

BINs2

Marker genes1

eDNA detections91

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus72 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

28Amostly conserved

37Gmostly conserved

40Gmostly conserved

64Cmostly conserved

160Amostly conserved

181Gmostly conserved

197Tmostly conserved

202Gmostly conserved

242Cmostly conserved

287Cmostly conserved

322Amostly conserved

328Amostly conserved

373Gmostly conserved

385Cmostly conserved

415Gmostly conserved

478Gmostly conserved

490Tmostly conserved

535Cmostly conserved

565Amostly conserved

574Amostly conserved

589Cmostly conserved

625Amostly conserved

634Tmostly conserved

646Cvariable

AACTCTTTACTTAATATTCGGAGCATGAGCAGGAATGGTGGGGACTGCCTTGAGTATATTAATCCGGGTAGAACTCGGACAACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.81%

Haplotypes10

BINs2

Most divergent pair3.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argia emmasame genus14.1%Chromagrion conditumsame family14.4%Anisopleura lestoidessame order14.5%Ophiogomphus rupinsulensissame order14.7%Ophiogomphus carolussame order14.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Argia moesta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size880 200 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Argia moesta0.88 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type31 378 records

Wild obs. + sensor26 368

Museum / vouchered5 010

Origin

Native8

Range

Area of Occupancy AOO39 644 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 10 393≤1 km 4 617≤10 km 923>10 km 2 242

18 175 georeferenced · 8 193 without coordinates

Open the mapobservation + sensor26 368

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 314≤1 km 401≤10 km 669>10 km 158

1 542 georeferenced · 3 468 without coordinates

Open the institutions mapphysical evidence5 010

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Odonata Centrallocation not on record	989
Washington, US	882
Wuzhou, CN	281
Saint John, CA	254
Montréal, CA	221
Champaign, US	188
Mexico City, MX	150
Cornell University Insect Collectionlocation not on record	142
OSUClocation not on record	134
East Lansing, US	120
Cleveland Museum of Natural History, OH (CLEV)location not on record	120
Toronto, CA	101
College Station, US	78
University Park, US	61
New Haven, US	40
St. Paul, US	40
Sam Noble Oklahoma Museum of Natural Historylocation not on record	33
Lubbock, US	29
Chicago, US	19
Université Lavallocation not on record	14
Ville de Montréal, Espace pour la Vielocation not on record	13
Provo, US	13
CASlocation not on record	9
University of Guelph, Centre for Biodiversity Genomicslocation not on record	8
Los Angeles, US	7
US	6
UCBMElocation not on record	5
San Francisco, US	5
Essig Museum of Entomologylocation not on record	5
Natural History Museum of Utahlocation not on record	4
Montgomery, US	3
Gouvernement du Québeclocation not on record	2
Vancouver, CA	1
The University of the West Indies, Trinidad and Tobagolocation not on record	1
Philadelphia, US	1

35 institutions · 3 979 of 5 010 vouchered records shown · 1 031 without an institution code

09Environmental DNA91 detections

Where the DNA of Argia moesta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found91

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 91 detections have coordinates

Open the map2 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.2 °C 18.9–28.7

Seasonal swing summer↔winter23.4 °C

Max temp (day)27.2 °C 23.2–33.6

Min temp (night)17.8 °C 16.0–25.0

Precipitation107 mm/mo 54.7–133

Air humidity59.4 % 53.2–62.2

Moisture balance-53.5 mm/mo -162–-16.9

Vapour deficit1,122 Pa 821–1,813

Wind speed2.90 m/s 2.20–4.50

Cloud cover38.9 % 22.8–40.1

CHELSA 1981–2010, ~9 km grid, at location & month of 87 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argia moesta

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Record type31 378 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions21 of 35 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type31 378 records