Argia fumipennis

(Burmeister, 1839) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Odonata/Coenagrionidae/Argia

At a glance

Occurrence records25 393

Data sources10

Biological traits0

DNA specimens38

eDNA detections40

Sources10 archives

Databases and archives Argia fumipennis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility25 393 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI40 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF25 393 records

Environmental DNA1 datasets · 2 countries40 detections

DNA & barcodingBOLD38 specimens

Genome at a glanceGoaT · TreeOfSex910 Mbp

01Narrative

The variable dancer (Argia fumipennis) is a damselfly of the family Coenagrionidae. It is native to North America, where it is widespread throughout the east and present in the interior western United States.Argia fumipennis. NatureServe. 2012. The male of the subspecies A. f. violacea (the violet dancer) is purple with a blue tip.Paseka, J. M. Argia fumipennis violacea. Nebraska Dragonflies and Damselflies. 2010.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Argia fumipennis has left across the world's sequence archives.

At a glance

DNA specimens38

BINs2

Marker genes1

eDNA detections40

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus36 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 22 variable positions, in barcode order

46Cvariable

49Gvariable

88Amostly conserved

100Gvariable

154Cvariable

157Cvariable

181Gvariable

184Avariable

187Tvariable

212Tvariable

220Avariable

271Tvariable

274Tvariable

290Cvariable

373Avariable

374Gmostly conserved

406Tvariable

433Gvariable

455Amostly conserved

497Cmostly conserved

643Avariable

646Cvariable

AACTCTTTATTTAATATTTGGAGCATGGGCAGGAATAGTAGGAACCGCGCTTAGAATACTAATTCGAGTAGAACTAGGACAACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes7

BINs2

Most divergent pair3.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Argia hineisame genus6.6%Argia bipunctulatasame genus11.9%Africallagma sapphirinumsame family12.0%Africallagma quingentumsame family12.6%Africallagma elongatumsame family12.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Argia fumipennis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size909 540 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Argia fumipennis0.91 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Chromosome records28–282n range28median28mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 284×GoaT · Animal Chromosome Counts Database · GoaT · Animal Genome Size Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Animal Genome Size Database — ↗

TreeOfSex · invert — Cruden RW (1968) Chromosome numbers of some North American dragonflies (Odonata). Canadian Journal of Genetics and Cytology 10: 200-214. ↗

2n 271×GoaT · Animal Chromosome Counts Database

GoaT · Animal Chromosome Counts Database — ↗

08Occurrence & distribution

Record type25 393 records

Wild obs. + sensor22 150

Museum / vouchered3 243

Range

Area of Occupancy AOO38 412 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 7 656≤1 km 3 768≤10 km 741>10 km 2 772

14 937 georeferenced · 7 213 without coordinates

Open the mapobservation + sensor22 150

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 51≤1 km 234≤10 km 379>10 km 94

758 georeferenced · 2 485 without coordinates

Open the institutions mapphysical evidence3 243

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Odonata Centrallocation not on record	729
Saint John, CA	373
Washington, US	217
Cornell University Insect Collectionlocation not on record	124
East Lansing, US	91
Champaign, US	82
University of Central Floridalocation not on record	79
New Haven, US	76
Lubbock, US	26
St. Paul, US	17
Wuzhou, CN	15
Toronto, CA	14
Mexico City, MX	11
University Park, US	10
Chicago, US	8
Montréal, CA	7
Cleveland Museum of Natural History, OH (CLEV)location not on record	5
San Diego, US	4
Montgomery, US	3
College Station, US	2
San Luis Potosí, MX	2
Sam Noble Oklahoma Museum of Natural Historylocation not on record	2
Vancouver, CA	1
Philadelphia, US	1
Essig Museum of Entomologylocation not on record	1
Durango, MX	1
Georgia Museum of Natural Historylocation not on record	1

27 institutions · 1 902 of 3 243 vouchered records shown · 1 341 without an institution code

09Environmental DNA40 detections

Where the DNA of Argia fumipennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found40

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 40 detections have coordinates

Open the map2 countries0

ForestMixed HabitatRiparian Zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.4 °C 18.1–27.6

Seasonal swing summer↔winter18.2 °C

Max temp (day)29.3 °C 23.2–33.2

Min temp (night)18.5 °C 14.3–23.1

Precipitation92.3 mm/mo 85.3–108

Air humidity57.6 % 56.7–61.8

Moisture balance-67.9 mm/mo -91.2–-0.8

Vapour deficit1,202 Pa 806–1,510

Wind speed2.50 m/s 2.00–3.70

Cloud cover37.3 % 29.3–40.8

CHELSA 1981–2010, ~9 km grid, at location & month of 36 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Argia fumipennis

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type25 393 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions20 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type25 393 records