Arge melanochra

(Gmelin, 1790) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Argidae/Arge

At a glance

Occurrence records1 662

Data sources6

Biological traits0

DNA specimens29

eDNA detections1

Sources6 archives

Databases and archives Arge melanochra's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 662 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 662 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD29 specimens

01Narrative

Arge melanochra est une espèce d'insectes hyménoptères symphytes de la famille des Argidae. Synonyme : - Arge melanochroa

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arge melanochra has left across the world's sequence archives.

At a glance

DNA specimens29

BINs1

Marker genes1

eDNA detections1

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus27 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 81 variable positions, in barcode order

2Amostly conserved

3Cmostly conserved

5Tmostly conserved

6Tmostly conserved

7Amostly conserved

9Amostly conserved

11Tmostly conserved

14Amostly conserved

17Tmostly conserved

18Tmostly conserved

19Tmostly conserved

20Gmostly conserved

21Gmostly conserved

22Amostly conserved

23Amostly conserved

24Tmostly conserved

25Tmostly conserved

27Gmostly conserved

29Tmostly conserved

30Cmostly conserved

32Gmostly conserved

33Gmostly conserved

38Amostly conserved

39Tmostly conserved

41Gmostly conserved

42Gmostly conserved

43Amostly conserved

44Cmostly conserved

45Tmostly conserved

46Tmostly conserved

47Tmostly conserved

48Cmostly conserved

49Amostly conserved

50Cmostly conserved

51Tmostly conserved

52Tmostly conserved

54Gmostly conserved

58Amostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

68Amostly conserved

69Cmostly conserved

71Gmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

76Amostly conserved

77Amostly conserved

78Gmostly conserved

79Tmostly conserved

80Tmostly conserved

81Cmostly conserved

82Amostly conserved

84Tmostly conserved

86Gmostly conserved

87Gmostly conserved

88Tmostly conserved

90Cmostly conserved

92Tmostly conserved

94Amostly conserved

96Tmostly conserved

97Tmostly conserved

98Amostly conserved

100Amostly conserved

103Tmostly conserved

106Tmostly conserved

217Amostly conserved

277Gvariable

310Tmostly conserved

316Amostly conserved

322Amostly conserved

373Amostly conserved

397Tmostly conserved

478Amostly conserved

539Tmostly conserved

541Amostly conserved

622Amostly conserved

634Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGATCAGGAATAATAGGACTTTCACTTAGAATAATTATTCGAACAGAATTAAGTTCAGTTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.4%

Haplotypes8

BIN1

Most divergent pair2.6%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arge cingulatasame genus1.5%Arge clavicornissame genus5.5%Arge ustulatasame genus5.6%Arge ciliarissame genus5.7%Arge macleayisame genus5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 662 records

Wild obs. + sensor1 484

Museum / vouchered173

Cultivated / captive2

Other3

Range

Area of Occupancy AOO4 216 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 482≤1 km 210≤10 km 487>10 km 20

1 199 georeferenced · 285 without coordinates

Open the mapobservation + sensor1 484

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 18≤1 km 68≤10 km 48>10 km 1

135 georeferenced · 38 without coordinates

Open the institutions mapphysical evidence173

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	67
Zürich, CH	48
Institute of Zoology Slovak Academy of Scienceslocation not on record	18
Muzeum Górnośląskie w Bytomiulocation not on record	14
ZSMlocation not on record	8
Nijmegen, NL	2
Tilburg, NL	2
Ugentlocation not on record	2
Natural History Museum, Londonlocation not on record	1

9 institutions · 162 of 173 vouchered records shown · 11 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Arge melanochra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arge melanochra

At a glance

Sources6 archives

At a glance

Record type1 662 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions3 of 9 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 662 records