Arge clavicornis

(Fabricius, 1781) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Argidae/Arge

At a glance

Occurrence records287

Data sources4

Biological traits0

DNA specimens9

eDNA detections3

Sources4 archives

Databases and archives Arge clavicornis's data was compiled from.

GBIFGlobal Biodiversity Information Facility287 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF287 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD9 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arge clavicornis has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes1

eDNA detections3

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

88Gmostly conserved

220Tmostly conserved

241Amostly conserved

250Tmostly conserved

271Tvariable

283Tmostly conserved

305Gmostly conserved

343Amostly conserved

400Amostly conserved

433Avariable

565Tmostly conserved

607Tmostly conserved

634Tmostly conserved

TACATTATATTTTATTTTTGGAATTTGAGCAGGAATAATAGGACTTTCATTTAGAATAATTATTCGTACAGAATTAAGTTCAGTAGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.79%

Haplotypes3

BINs2

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arge ustulatasame genus1.8%Arge ciliarissame genus1.8%Arge onerosasame genus2.3%Arge nigripessame genus2.4%Arge fuscipessame genus2.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type287 records

Wild obs. + sensor30

Museum / vouchered257

Range

Area of Occupancy AOO608 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 14≤1 km 14

28 georeferenced · 2 without coordinates

Open the mapobservation + sensor30

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy18% within 1 km

≤100 m 12≤1 km 10≤10 km 99

121 georeferenced · 136 without coordinates

Open the institutions mapphysical evidence257

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
OSUClocation not on record	108
Champaign, US	107
WIlocation not on record	16
NHMOlocation not on record	9
Vancouver, CA	8
Edmonton, CA	4
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	1
Metsähallituslocation not on record	1
SLU Artdatabankenlocation not on record	1
Bonn, DE	1

10 institutions · 256 of 257 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Arge clavicornis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)