Arge fuscipes

(Fallén, 1808) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Argidae/Arge

At a glance

Occurrence records829

Data sources5

Biological traits0

DNA specimens78

eDNA detections0

Sources5 archives

Databases and archives Arge fuscipes's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility829 records↗

BOLD SystemsCentre for Biodiversity Genomics78 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF829 records

DNA & barcodingBOLD78 specimens

01Narrative

Arge fuscipes is een vliesvleugelig insect uit de familie van de Argidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1808 door Fallen.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding78 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arge fuscipes has left across the world's sequence archives.

At a glance

DNA specimens78

BINs2

Marker genes1

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus74 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

1Tmostly conserved

2Amostly conserved

3Cmostly conserved

22Amostly conserved

25Cmostly conserved

88Gmostly conserved

127Tmostly conserved

217Amostly conserved

271Cmostly conserved

283Cmostly conserved

305Gvariable

316Gmostly conserved

337Cmostly conserved

340Cmostly conserved

400Tmostly conserved

592Tmostly conserved

625Gmostly conserved

TACATTATATTTTATTTTTGGAATCTGAGCAGGAATAATAGGACTTTCATTTAGAATAATTATTCGTACAGAATTAAGTTCAGTAGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.0%

Haplotypes10

BINs2

Most divergent pair3.3%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arge ustulatasame genus1.7%Arge ciliarissame genus1.7%Arge sorbisame genus2.0%Arge clavicornissame genus2.4%Arge cyrasame genus2.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type829 records

Wild obs. + sensor153

Museum / vouchered674

Other2

Range

Area of Occupancy AOO1 408 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 38≤1 km 47≤10 km 47>10 km 1

133 georeferenced · 20 without coordinates

Open the mapobservation + sensor153

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 37≤1 km 93≤10 km 374>10 km 14

518 georeferenced · 156 without coordinates

Open the institutions mapphysical evidence674

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	428
NHMOlocation not on record	61
Oulu, FI	45
BioFokuslocation not on record	12
Provincia di Livornolocation not on record	12
Tartu, EE	9
Muzeum Górnośląskie w Bytomiulocation not on record	8
ZSMlocation not on record	7
Tilburg, NL	6
Philadelphia, US	4
Zürich, CH	3
NEFlocation not on record	2
ZMAAlocation not on record	2
Bavarian State Collection of Zoologylocation not on record	1
neflocation not on record	1
MZLUlocation not on record	1

16 institutions · 602 of 674 vouchered records shown · 72 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)