Arge ciliaris

(Linnaeus, 1767) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Argidae/Arge

At a glance

Occurrence records1 245

Data sources7

Biological traits0

DNA specimens126

eDNA detections1

Sources7 archives

Databases and archives Arge ciliaris's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 245 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics126 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 245 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD126 specimens

01Narrative

Arge ciliaris ist eine Pflanzenwespe aus der Familie der Bürstenhornblattwespen. Sie ist in Europa verbreitet und eine von 18 Arten der Gattung in Deutschland.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding126 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arge ciliaris has left across the world's sequence archives.

At a glance

DNA specimens126

BINs1

Marker genes1

eDNA detections1

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus121 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

124Cvariable

214Gmostly conserved

359Gvariable

475Amostly conserved

628Avariable

ATTATATTTTATTTTTGGAATCTGAGCAGGAATAATAGGACTTTCATTTAGAATAATTATTCGTACAGAATTAAGTTCAGTAGGATCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.57%

Haplotypes14

BIN1

Most divergent pair2.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arge annulatasame genus1.5%Arge fuscipessame genus1.7%Arge expansasame genus1.7%Arge clavicornissame genus1.8%Arge macleayisame genus2.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 245 records

Wild obs. + sensor233

Museum / vouchered989

Other23

Range

Area of Occupancy AOO2 016 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 104≤1 km 49≤10 km 55>10 km 3

211 georeferenced · 22 without coordinates

Open the mapobservation + sensor233

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 23≤1 km 126≤10 km 543>10 km 46

738 georeferenced · 251 without coordinates

Open the institutions mapphysical evidence989

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	644
Oulu, FI	105
NHMOlocation not on record	40
Provincia di Livornolocation not on record	25
BioFokuslocation not on record	21
ZSMlocation not on record	17
Zürich, CH	15
ZMAAlocation not on record	11
Gothenburg, SE	7
Philadelphia, US	6
neflocation not on record	5
Bonn, DE	5
Stockholm, SE	4
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	4
SLU Artdatabankenlocation not on record	3
DFFW2018location not on record	3
MZLUlocation not on record	2
Natural History Museum, Londonlocation not on record	2
Bavarian State Collection of Zoologylocation not on record	2
Muzeum Górnośląskie w Bytomiulocation not on record	2
NEFlocation not on record	2
Tilburg, NL	1
University of Oululocation not on record	1
Metsähallituslocation not on record	1

24 institutions · 928 of 989 vouchered records shown · 61 without an institution code

09Environmental DNA1 detections

Where the DNA of Arge ciliaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.8 °C 12.8–12.8

Seasonal swing summer↔winter25.4 °C

Max temp (day)15.4 °C

Min temp (night)8.60 °C

Precipitation63.5 mm/mo

Air humidity57.8 %

Moisture balance-62.0 mm/mo

Vapour deficit622 Pa

Wind speed4.80 m/s

Cloud cover53.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arge ciliaris

At a glance

Sources7 archives

At a glance

Record type1 245 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 245 records