Arge ustulata

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Argidae/Arge

At a glance

Occurrence records7 080

Data sources9

Biological traits0

DNA specimens203

eDNA detections3

Sources9 archives

Databases and archives Arge ustulata's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 080 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics203 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF7 080 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD203 specimens

Genome at a glanceGoaT · TreeOfSex2n = 16

01Narrative

Calameuta pallipes is a Palearctic species of sawfly.Benson, R.B., 1952. Handbooks for the Identification of British Insects. Hymenoptera, Symphyta, Vol 6, Section 2(a-c), Royal Entomological Society, London

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding203 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arge ustulata has left across the world's sequence archives.

At a glance

DNA specimens203

BINs1

Marker genes1

eDNA detections3

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus199 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 20 variable positions, in barcode order

17Tvariable

71Avariable

86Amostly conserved

125Tvariable

131Avariable

212Amostly conserved

215Gmostly conserved

233Tvariable

281Tvariable

333Gmostly conserved

353Tvariable

360Gvariable

476Amostly conserved

548Avariable

579Tmostly conserved

614Cvariable

623Tmostly conserved

626Amostly conserved

632Cvariable

644Cvariable

CATTATATTTTATTTTTGGAATCTGAGCAGGAATAATAGGACTTTCATTTAGAATAATTATTCGTACAGAATTAAGTTCAGTAGGATCAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes28

BIN1

Most divergent pair3.1%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arge annulatasame genus1.5%Arge fuscipessame genus1.7%Arge clavicornissame genus1.8%Arge macleayisame genus2.0%Arge cyrasame genus2.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Arge ustulata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Chromosome records8–162n range16median16mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 163×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Gokhman, V. E. "Karyotypes of parasitic Hymenoptera: evolution, systematic and phylogenetic implications." Unpublished D. Sc. thesis. Moscow: Moscow State University (2003). ↗

2n 81×GoaT · Tree of Sex Database

GoaT · Tree of Sex Database — ↗

08Occurrence & distribution

Record type7 080 records

Wild obs. + sensor4 354

Museum / vouchered2 710

Other16

Range

Area of Occupancy AOO12 120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy43% within 1 km

≤100 m 1 118≤1 km 593≤10 km 2 210>10 km 18

3 939 georeferenced · 415 without coordinates

Open the mapobservation + sensor4 354

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤100 m 150≤1 km 336≤10 km 1 422>10 km 95

2 003 georeferenced · 707 without coordinates

Open the institutions mapphysical evidence2 710

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	1 549
NHMOlocation not on record	190
Oulu, FI	142
Provincia di Livornolocation not on record	116
Muzeum Górnośląskie w Bytomiulocation not on record	79
BioFokuslocation not on record	66
ZMAAlocation not on record	56
Zürich, CH	40
Tilburg, NL	33
Bonn, DE	24
SLU Artdatabankenlocation not on record	24
neflocation not on record	22
Tartu, EE	17
ZSMlocation not on record	15
Stockholm, SE	11
Philadelphia, US	11
Natural History Museum Rotterdamlocation not on record	9
NEFlocation not on record	7
NCMGlocation not on record	6
Nijmegen, NL	5
Gothenburg, SE	5
Ugentlocation not on record	4
Rovaniemi, FI	2
South Kensington, GB	2
NTNU-VMlocation not on record	2
Metsähallituslocation not on record	1
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	1
Institute of Zoology Slovak Academy of Scienceslocation not on record	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
University of Oululocation not on record	1

30 institutions · 2 442 of 2 710 vouchered records shown · 268 without an institution code

09Environmental DNA3 detections

Where the DNA of Arge ustulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.6 °C 11.6–11.6

Seasonal swing summer↔winter26.8 °C

Max temp (day)14.6 °C

Min temp (night)7.20 °C

Precipitation81.1 mm/mo

Air humidity57.3 %

Moisture balance-17.9 mm/mo

Vapour deficit586 Pa

Wind speed2.50 m/s

Cloud cover59.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arge ustulata

At a glance

Sources9 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type7 080 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 30 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 080 records